Incidental Mutation 'R5368:Epb42'
ID429460
Institutional Source Beutler Lab
Gene Symbol Epb42
Ensembl Gene ENSMUSG00000023216
Gene Nameerythrocyte membrane protein band 4.2
SynonymsEpb4.2
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121017891-121037072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121019462 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 689 (V689I)
Ref Sequence ENSEMBL: ENSMUSP00000099548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023987] [ENSMUST00000060455] [ENSMUST00000099488] [ENSMUST00000099489] [ENSMUST00000102490] [ENSMUST00000171260]
Predicted Effect probably benign
Transcript: ENSMUST00000023987
SMART Domains Protein: ENSMUSP00000023987
Gene: ENSMUSG00000023216

DomainStartEndE-ValueType
Pfam:Transglut_N 5 126 8.9e-35 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 552 5.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060455
SMART Domains Protein: ENSMUSP00000062496
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 50 318 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099488
SMART Domains Protein: ENSMUSP00000097087
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 50 311 4.8e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099489
SMART Domains Protein: ENSMUSP00000097088
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 3 271 3.7e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102490
AA Change: V689I

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099548
Gene: ENSMUSG00000023216
AA Change: V689I

DomainStartEndE-ValueType
Pfam:Transglut_N 6 124 5.8e-34 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 580 8e-23 PFAM
Pfam:Transglut_C 588 686 8.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147444
Predicted Effect probably benign
Transcript: ENSMUST00000171260
SMART Domains Protein: ENSMUSP00000125961
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 52 309 4.7e-74 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: The protein encoded by this gene is the key component of a macromolecular complex involved in the structure of erythrocytes. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit erythrocytic abnormalities including mild spherocytosis, altered ion transport, and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Epb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Epb42 APN 2 121027688 missense probably damaging 1.00
IGL01627:Epb42 APN 2 121025843 missense probably benign 0.06
IGL02059:Epb42 APN 2 121024707 missense probably damaging 0.96
IGL02869:Epb42 APN 2 121025746 missense probably benign
R0279:Epb42 UTSW 2 121029044 splice site probably benign
R0521:Epb42 UTSW 2 121029150 nonsense probably null
R1457:Epb42 UTSW 2 121029967 critical splice donor site probably null
R2157:Epb42 UTSW 2 121021762 missense probably benign
R2392:Epb42 UTSW 2 121029987 missense possibly damaging 0.85
R2407:Epb42 UTSW 2 121024752 missense probably damaging 1.00
R2866:Epb42 UTSW 2 121025921 missense possibly damaging 0.93
R2993:Epb42 UTSW 2 121029044 splice site probably benign
R3426:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R3427:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R4192:Epb42 UTSW 2 121030089 splice site probably null
R4940:Epb42 UTSW 2 121034451 missense probably damaging 1.00
R5771:Epb42 UTSW 2 121021820 missense probably damaging 0.99
R6048:Epb42 UTSW 2 121024408 missense probably benign 0.00
R6362:Epb42 UTSW 2 121025779 missense possibly damaging 0.72
R6475:Epb42 UTSW 2 121027133 missense possibly damaging 0.53
R6711:Epb42 UTSW 2 121024108 intron probably benign
R6843:Epb42 UTSW 2 121027685 missense possibly damaging 0.85
R6895:Epb42 UTSW 2 121036623 start gained probably benign
R7154:Epb42 UTSW 2 121033362 missense probably benign 0.01
R7192:Epb42 UTSW 2 121024097 missense unknown
R7600:Epb42 UTSW 2 121021826 missense probably damaging 1.00
R7757:Epb42 UTSW 2 121027719 missense possibly damaging 0.91
R7779:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7781:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7782:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7783:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7784:Epb42 UTSW 2 121034435 missense probably benign 0.14
R8737:Epb42 UTSW 2 121025843 missense possibly damaging 0.75
Z1177:Epb42 UTSW 2 121027725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAGGTTGGCTTGATACAAATG -3'
(R):5'- ATCAGTGGAGCAATGATCCAG -3'

Sequencing Primer
(F):5'- ATCTACAGAGTGAGTTCCTGGACC -3'
(R):5'- TGATCCAGAGGAGAATTAACACC -3'
Posted On2016-09-06