Incidental Mutation 'R5368:Prdm16'
ID429470
Institutional Source Beutler Lab
Gene Symbol Prdm16
Ensembl Gene ENSMUSG00000039410
Gene NamePR domain containing 16
SynonymsMel1, 5730557K01Rik, csp1, line 27
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154316125-154636873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 154345391 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 373 (K373Q)
Ref Sequence ENSEMBL: ENSMUSP00000101262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030902] [ENSMUST00000070313] [ENSMUST00000097759] [ENSMUST00000105636] [ENSMUST00000105637] [ENSMUST00000105638] [ENSMUST00000181143]
Predicted Effect probably damaging
Transcript: ENSMUST00000030902
AA Change: K374Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030902
Gene: ENSMUSG00000039410
AA Change: K374Q

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 951 973 5.29e-5 SMART
ZnF_C2H2 979 1002 1.6e-4 SMART
ZnF_C2H2 1008 1030 7.26e-3 SMART
low complexity region 1116 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070313
AA Change: K375Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064546
Gene: ENSMUSG00000039410
AA Change: K375Q

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 953 975 5.29e-5 SMART
ZnF_C2H2 981 1004 1.6e-4 SMART
ZnF_C2H2 1010 1032 7.26e-3 SMART
low complexity region 1118 1134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097759
AA Change: K374Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095365
Gene: ENSMUSG00000039410
AA Change: K374Q

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105636
AA Change: K375Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101261
Gene: ENSMUSG00000039410
AA Change: K375Q

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105637
AA Change: K373Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101262
Gene: ENSMUSG00000039410
AA Change: K373Q

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 216 8.75e-5 SMART
ZnF_C2H2 229 249 2.82e1 SMART
low complexity region 259 273 N/A INTRINSIC
ZnF_C2H2 281 303 1.04e-3 SMART
ZnF_C2H2 309 331 1.6e-4 SMART
ZnF_C2H2 337 360 3.95e-4 SMART
ZnF_C2H2 366 388 1.95e-3 SMART
ZnF_C2H2 394 416 8.22e-2 SMART
ZnF_C2H2 423 450 9.96e0 SMART
low complexity region 495 516 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 609 640 N/A INTRINSIC
ZnF_C2H2 950 972 5.29e-5 SMART
ZnF_C2H2 978 1001 1.6e-4 SMART
ZnF_C2H2 1007 1029 7.26e-3 SMART
low complexity region 1115 1131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105638
AA Change: K374Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101263
Gene: ENSMUSG00000039410
AA Change: K374Q

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141164
Predicted Effect probably benign
Transcript: ENSMUST00000181143
SMART Domains Protein: ENSMUSP00000138001
Gene: ENSMUSG00000097871

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Meta Mutation Damage Score 0.1545 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit a cleft secondary palate, whitening of brown adipose tissue in older or fed a high-fat diet, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Prdm16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Prdm16 APN 4 154341969 missense possibly damaging 0.89
IGL01517:Prdm16 APN 4 154328425 missense probably damaging 1.00
IGL01810:Prdm16 APN 4 154347927 missense probably benign 0.10
IGL02260:Prdm16 APN 4 154328287 missense probably benign 0.00
IGL02623:Prdm16 APN 4 154340877 missense probably damaging 0.98
IGL02744:Prdm16 APN 4 154345453 missense probably damaging 1.00
R0126:Prdm16 UTSW 4 154328838 splice site probably benign
R0345:Prdm16 UTSW 4 154341111 missense probably benign 0.09
R0365:Prdm16 UTSW 4 154342056 missense probably damaging 1.00
R0440:Prdm16 UTSW 4 154476627 splice site probably benign
R0899:Prdm16 UTSW 4 154528909 missense probably damaging 1.00
R1127:Prdm16 UTSW 4 154528799 missense probably damaging 1.00
R1546:Prdm16 UTSW 4 154528660 missense possibly damaging 0.94
R1803:Prdm16 UTSW 4 154335261 missense probably damaging 1.00
R2117:Prdm16 UTSW 4 154347925 missense probably null 0.99
R3814:Prdm16 UTSW 4 154328293 missense probably damaging 1.00
R4348:Prdm16 UTSW 4 154476667 missense probably benign 0.00
R4458:Prdm16 UTSW 4 154322308 missense probably benign
R4557:Prdm16 UTSW 4 154528827 missense probably benign 0.01
R4581:Prdm16 UTSW 4 154323353 missense probably damaging 1.00
R4584:Prdm16 UTSW 4 154337683 missense probably damaging 1.00
R4627:Prdm16 UTSW 4 154367240 missense probably damaging 1.00
R4926:Prdm16 UTSW 4 154341552 missense possibly damaging 0.74
R5055:Prdm16 UTSW 4 154335262 missense possibly damaging 0.48
R5152:Prdm16 UTSW 4 154346102 missense probably damaging 0.99
R5257:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5258:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5464:Prdm16 UTSW 4 154346144 critical splice acceptor site probably null
R5640:Prdm16 UTSW 4 154341910 missense probably benign
R5744:Prdm16 UTSW 4 154528704 missense probably damaging 1.00
R5892:Prdm16 UTSW 4 154323259 missense possibly damaging 0.74
R5938:Prdm16 UTSW 4 154347954 missense probably damaging 0.99
R6380:Prdm16 UTSW 4 154341367 missense probably benign 0.00
R6784:Prdm16 UTSW 4 154323307 missense probably damaging 1.00
R7097:Prdm16 UTSW 4 154345468 missense probably damaging 1.00
R7181:Prdm16 UTSW 4 154528637 missense probably damaging 1.00
R7197:Prdm16 UTSW 4 154341510 missense probably damaging 1.00
R7273:Prdm16 UTSW 4 154345453 missense probably damaging 1.00
R7379:Prdm16 UTSW 4 154528859 missense probably damaging 1.00
R7641:Prdm16 UTSW 4 154345444 missense probably damaging 1.00
R7704:Prdm16 UTSW 4 154341490 missense probably damaging 1.00
R7751:Prdm16 UTSW 4 154328299 missense probably damaging 1.00
R8048:Prdm16 UTSW 4 154320882 missense probably damaging 1.00
R8225:Prdm16 UTSW 4 154355245 critical splice donor site probably null
RF008:Prdm16 UTSW 4 154341995 missense probably damaging 1.00
X0010:Prdm16 UTSW 4 154323377 missense probably damaging 1.00
Z1176:Prdm16 UTSW 4 154341786 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTAACAGAGTAACGGCGTG -3'
(R):5'- ACAGCAAGAGGTATCCTGGC -3'

Sequencing Primer
(F):5'- AACGGCGTGGTGTCACATTC -3'
(R):5'- GTATCCTGGCCAGCTCAGTATAAG -3'
Posted On2016-09-06