Incidental Mutation 'R5368:Kirrel3'
ID429483
Institutional Source Beutler Lab
Gene Symbol Kirrel3
Ensembl Gene ENSMUSG00000032036
Gene Namekirre like nephrin family adhesion molecule 3
Synonyms2900036G11Rik, Neph2, 1500010O20Rik
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location34485894-35036716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35007738 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 230 (E230G)
Ref Sequence ENSEMBL: ENSMUSP00000139418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045091] [ENSMUST00000115148] [ENSMUST00000187182] [ENSMUST00000187625] [ENSMUST00000188933] [ENSMUST00000190549]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045091
AA Change: E230G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048863
Gene: ENSMUSG00000032036
AA Change: E230G

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115148
AA Change: E263G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110801
Gene: ENSMUSG00000032036
AA Change: E263G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 54 144 1.35e-9 SMART
IG 155 247 2.56e-1 SMART
Pfam:Ig_3 249 318 7.2e-6 PFAM
IGc2 347 405 1.66e-9 SMART
IG 425 517 1.06e-2 SMART
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 733 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187182
AA Change: E237G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140219
Gene: ENSMUSG00000032036
AA Change: E237G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 28 118 1.35e-9 SMART
IG 129 221 2.56e-1 SMART
Pfam:Ig_2 224 305 2.3e-6 PFAM
IGc2 321 379 1.66e-9 SMART
IG 399 491 1.06e-2 SMART
transmembrane domain 510 532 N/A INTRINSIC
low complexity region 612 625 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187625
AA Change: E230G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139951
Gene: ENSMUSG00000032036
AA Change: E230G

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188933
AA Change: E230G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139418
Gene: ENSMUSG00000032036
AA Change: E230G

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 3.7e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 503 525 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 712 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190549
AA Change: E230G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139714
Gene: ENSMUSG00000032036
AA Change: E230G

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 2.6e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 491 513 N/A INTRINSIC
Meta Mutation Damage Score 0.1639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accessory olfactory bulb formation with reduced coalescence of vomeronasal sensory neuron axons in the posterior accessory olfactory bulb, loss of male-male aggression and abnormal male sexual response to a male intruder mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Kirrel3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Kirrel3 APN 9 35015253 critical splice acceptor site probably null
IGL01369:Kirrel3 APN 9 35016441 missense probably benign 0.07
IGL01837:Kirrel3 APN 9 35034928 missense probably damaging 1.00
IGL01950:Kirrel3 APN 9 35028329 splice site probably benign
IGL01973:Kirrel3 APN 9 35016468 missense probably damaging 1.00
IGL01994:Kirrel3 APN 9 35020133 missense possibly damaging 0.71
IGL03184:Kirrel3 APN 9 35007756 missense probably damaging 1.00
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0390:Kirrel3 UTSW 9 35020163 missense probably damaging 1.00
R0627:Kirrel3 UTSW 9 35035174 missense probably damaging 1.00
R0786:Kirrel3 UTSW 9 35034865 missense probably damaging 1.00
R0920:Kirrel3 UTSW 9 35028352 missense probably damaging 1.00
R0962:Kirrel3 UTSW 9 35000997 missense possibly damaging 0.95
R1716:Kirrel3 UTSW 9 35023547 missense probably damaging 1.00
R2010:Kirrel3 UTSW 9 34939198 missense probably damaging 1.00
R4289:Kirrel3 UTSW 9 35023473 missense probably benign 0.44
R4888:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R4970:Kirrel3 UTSW 9 34944439 missense possibly damaging 0.88
R5121:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R5572:Kirrel3 UTSW 9 35000948 missense probably damaging 1.00
R5707:Kirrel3 UTSW 9 35013276 missense probably damaging 1.00
R6302:Kirrel3 UTSW 9 35007749 missense probably damaging 1.00
R6449:Kirrel3 UTSW 9 34990973 missense probably benign
R6908:Kirrel3 UTSW 9 35013401 missense possibly damaging 0.86
R6967:Kirrel3 UTSW 9 35034906 missense probably damaging 1.00
R7578:Kirrel3 UTSW 9 34939112 missense probably damaging 1.00
R7861:Kirrel3 UTSW 9 35020123 missense possibly damaging 0.79
R7944:Kirrel3 UTSW 9 35020123 missense possibly damaging 0.79
R8094:Kirrel3 UTSW 9 35035164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGGGAGCAAAGTCGC -3'
(R):5'- AAGAGAGTGTCTGCTTGGCC -3'

Sequencing Primer
(F):5'- AGCAAAGTCGCCTCCTGATGAG -3'
(R):5'- AGAGTGTCTGCTTGGCCAGTAG -3'
Posted On2016-09-06