Incidental Mutation 'R5368:Fam117a'
ID429491
Institutional Source Beutler Lab
Gene Symbol Fam117a
Ensembl Gene ENSMUSG00000038893
Gene Namefamily with sequence similarity 117, member A
Synonyms
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location95337018-95381872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95375633 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 193 (S193F)
Ref Sequence ENSEMBL: ENSMUSP00000049162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037502]
Predicted Effect probably damaging
Transcript: ENSMUST00000037502
AA Change: S193F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049162
Gene: ENSMUSG00000038893
AA Change: S193F

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
Pfam:FAM117 86 397 3.6e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189860
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Fam117a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02821:Fam117a APN 11 95363989 splice site probably benign
IGL03027:Fam117a APN 11 95377573 missense probably benign 0.00
R0328:Fam117a UTSW 11 95375626 splice site probably benign
R0603:Fam117a UTSW 11 95380873 missense probably damaging 0.99
R1779:Fam117a UTSW 11 95378953 missense probably damaging 1.00
R1941:Fam117a UTSW 11 95380798 missense probably damaging 1.00
R4801:Fam117a UTSW 11 95364070 missense probably damaging 0.99
R4802:Fam117a UTSW 11 95364070 missense probably damaging 0.99
R5328:Fam117a UTSW 11 95364170 critical splice donor site probably null
R6166:Fam117a UTSW 11 95380781 missense possibly damaging 0.89
R6267:Fam117a UTSW 11 95364145 missense possibly damaging 0.93
R6296:Fam117a UTSW 11 95364145 missense possibly damaging 0.93
R7077:Fam117a UTSW 11 95377672 missense probably benign 0.01
R7354:Fam117a UTSW 11 95380703 missense probably damaging 1.00
R7670:Fam117a UTSW 11 95378834 missense probably benign 0.00
R7673:Fam117a UTSW 11 95371496 missense probably benign 0.15
R8176:Fam117a UTSW 11 95337139 missense unknown
Z1088:Fam117a UTSW 11 95371524 missense possibly damaging 0.50
Z1177:Fam117a UTSW 11 95375025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGTCCCTTATAGTCCATAACC -3'
(R):5'- ACATGTTGTTGCTTGCAGAG -3'

Sequencing Primer
(F):5'- GTCCATAACCATGATGCTGTATG -3'
(R):5'- CTGAGAGTCCCCAAAGAGCG -3'
Posted On2016-09-06