Incidental Mutation 'R5368:Ecm2'
ID429495
Institutional Source Beutler Lab
Gene Symbol Ecm2
Ensembl Gene ENSMUSG00000043631
Gene Nameextracellular matrix protein 2, female organ and adipocyte specific
Synonymstenonectin, 9030618O22Rik
MMRRC Submission 043204-MU
Accession Numbers

Ncbi RefSeq: NM_001012324.2; MGI:3039578

Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49504810-49532789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49520943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 280 (T280P)
Ref Sequence ENSEMBL: ENSMUSP00000060402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000051504]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051504
AA Change: T280P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060402
Gene: ENSMUSG00000043631
AA Change: T280P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
VWC 98 152 1.37e-11 SMART
coiled coil region 235 269 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
LRR 314 336 1.41e2 SMART
LRR 337 362 1.76e-1 SMART
LRR 363 386 5.41e0 SMART
LRR 408 433 1.91e1 SMART
LRR 434 457 4.98e-1 SMART
LRR 459 478 8.03e1 SMART
LRR 506 528 2.76e1 SMART
LRR 529 549 1.19e2 SMART
LRR 578 600 1.81e1 SMART
LRR 601 624 9.48e0 SMART
LRR 631 655 6.06e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222592
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ECM2 encodes extracellular matrix protein 2, so named because it shares extensive similarity with known extracelluar matrix proteins. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Ecm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Ecm2 APN 13 49531318 missense probably benign 0.14
IGL01685:Ecm2 APN 13 49528898 missense probably damaging 1.00
IGL02070:Ecm2 APN 13 49518370 missense probably damaging 1.00
IGL02108:Ecm2 APN 13 49518444 nonsense probably null
IGL02138:Ecm2 APN 13 49522828 missense probably damaging 1.00
IGL02937:Ecm2 APN 13 49518476 missense probably damaging 0.99
IGL03350:Ecm2 APN 13 49520944 missense probably benign
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0627:Ecm2 UTSW 13 49521083 splice site probably benign
R1515:Ecm2 UTSW 13 49518332 missense possibly damaging 0.87
R1864:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1865:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1991:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2103:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2181:Ecm2 UTSW 13 49530289 missense probably damaging 1.00
R2209:Ecm2 UTSW 13 49530156 missense probably damaging 1.00
R2568:Ecm2 UTSW 13 49530129 missense possibly damaging 0.81
R4856:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R4867:Ecm2 UTSW 13 49531345 missense probably damaging 0.99
R4886:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R5420:Ecm2 UTSW 13 49527734 missense possibly damaging 0.65
R6084:Ecm2 UTSW 13 49515094 nonsense probably null
R6244:Ecm2 UTSW 13 49530307 missense probably damaging 1.00
R6881:Ecm2 UTSW 13 49530342 nonsense probably null
R6931:Ecm2 UTSW 13 49529011 missense probably benign 0.00
R7085:Ecm2 UTSW 13 49520902 missense probably damaging 1.00
R7347:Ecm2 UTSW 13 49515078 missense probably damaging 0.99
R7490:Ecm2 UTSW 13 49530342 nonsense probably null
R8039:Ecm2 UTSW 13 49514850 missense probably benign
R8131:Ecm2 UTSW 13 49518464 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCCTACTAAGATCCATGGCG -3'
(R):5'- TCATATGGCGGTAAAATTCACCC -3'

Sequencing Primer
(F):5'- CTGAGAGAAAACTGAGGCCG -3'
(R):5'- GGCGGTAAAATTCACCCTTATATCTG -3'
Posted On2016-09-06