Incidental Mutation 'R5368:Fyb'
ID429498
Institutional Source Beutler Lab
Gene Symbol Fyb
Ensembl Gene ENSMUSG00000022148
Gene NameFYN binding protein
SynonymsB630013F22Rik, ADAP, FYB-120/130
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6522853-6663313 bp(+) (GRCm38)
Type of Mutationunclassified (415 bp from exon)
DNA Base Change (assembly) A to G at 6580678 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090461] [ENSMUST00000160612] [ENSMUST00000226412] [ENSMUST00000227175]
Predicted Effect probably benign
Transcript: ENSMUST00000090461
AA Change: D244G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087947
Gene: ENSMUSG00000022148
AA Change: D244G

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
low complexity region 371 409 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 457 494 N/A INTRINSIC
SH3 502 559 1.24e-3 SMART
low complexity region 611 626 N/A INTRINSIC
Pfam:hSH3 731 819 2.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160612
SMART Domains Protein: ENSMUSP00000124553
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 27 65 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000226412
Predicted Effect probably null
Transcript: ENSMUST00000227175
Meta Mutation Damage Score 0.1242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: The protein encoded by this gene is an adapter molecule that affects T cell receptor signaling and contains multiple protein-protein interaction domains. It is thought to couple T cell receptor stimulation with activation of integrin function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation, thymocytes and platelet counts and decreased TCR-stimulated leukocyte adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Fyb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fyb APN 15 6580777 missense probably damaging 0.99
IGL00801:Fyb APN 15 6644824 missense possibly damaging 0.86
IGL00974:Fyb APN 15 6642585 unclassified probably benign
IGL01377:Fyb APN 15 6580320 missense probably benign 0.01
IGL01982:Fyb APN 15 6580177 missense probably null 0.99
IGL02173:Fyb APN 15 6580695 missense probably benign 0.00
IGL02177:Fyb APN 15 6658566 critical splice donor site probably null
IGL02345:Fyb APN 15 6619662 missense possibly damaging 0.94
IGL02695:Fyb APN 15 6580921 missense probably damaging 1.00
IGL02820:Fyb APN 15 6658559 missense possibly damaging 0.65
IGL02867:Fyb APN 15 6580046 missense probably damaging 1.00
luegner UTSW 15 6580869 nonsense probably null
uebeltaeter UTSW 15 6638907 missense probably damaging 1.00
P0023:Fyb UTSW 15 6651854 missense probably damaging 1.00
R0028:Fyb UTSW 15 6644914 intron probably benign
R0364:Fyb UTSW 15 6580791 missense probably damaging 1.00
R0507:Fyb UTSW 15 6634816 missense probably benign 0.39
R0588:Fyb UTSW 15 6580459 missense probably benign 0.03
R0742:Fyb UTSW 15 6634816 missense probably benign 0.39
R0930:Fyb UTSW 15 6638828 missense probably damaging 1.00
R1184:Fyb UTSW 15 6638900 missense probably damaging 1.00
R1446:Fyb UTSW 15 6652466 missense probably benign 0.02
R1481:Fyb UTSW 15 6619647 missense probably benign 0.01
R1711:Fyb UTSW 15 6580479 missense probably damaging 1.00
R2041:Fyb UTSW 15 6644787 missense possibly damaging 0.78
R2176:Fyb UTSW 15 6579954 missense probably damaging 1.00
R2224:Fyb UTSW 15 6652383 missense probably damaging 1.00
R2372:Fyb UTSW 15 6651907 splice site probably benign
R3236:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4117:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4181:Fyb UTSW 15 6580923 missense probably benign 0.00
R4322:Fyb UTSW 15 6580819 missense possibly damaging 0.84
R4952:Fyb UTSW 15 6638811 missense probably damaging 1.00
R4981:Fyb UTSW 15 6646611 splice site probably benign
R5055:Fyb UTSW 15 6585149 unclassified probably benign
R5719:Fyb UTSW 15 6580869 nonsense probably null
R5822:Fyb UTSW 15 6663226 unclassified probably benign
R6064:Fyb UTSW 15 6638868 missense probably damaging 1.00
R6929:Fyb UTSW 15 6638907 missense probably damaging 1.00
R7125:Fyb UTSW 15 6644856 missense possibly damaging 0.77
R7243:Fyb UTSW 15 6643699 missense probably benign 0.19
R7748:Fyb UTSW 15 6638826 missense probably damaging 1.00
R7750:Fyb UTSW 15 6660703 missense probably damaging 1.00
R7902:Fyb UTSW 15 6660716 critical splice donor site probably null
R7985:Fyb UTSW 15 6660716 critical splice donor site probably null
R8182:Fyb UTSW 15 6651812 missense probably benign
Z1088:Fyb UTSW 15 6658540 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GGATTCTCAAAGGTAGCTGGAGC -3'
(R):5'- GCCGGCTCTTCTTGATTCAG -3'

Sequencing Primer
(F):5'- GCAAGTTCATGCCAGCG -3'
(R):5'- GATTCAGTTTGTTCAGAAAGATGTTC -3'
Posted On2016-09-06