Incidental Mutation 'R5368:Lypd2'
ID429500
Institutional Source Beutler Lab
Gene Symbol Lypd2
Ensembl Gene ENSMUSG00000022595
Gene NameLy6/Plaur domain containing 2
Synonyms0610005K03Rik
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5368 (G1)
Quality Score190
Status Validated
Chromosome15
Chromosomal Location74732247-74734329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74733059 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 29 (A29E)
Ref Sequence ENSEMBL: ENSMUSP00000023260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023260]
Predicted Effect probably benign
Transcript: ENSMUST00000023260
AA Change: A29E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023260
Gene: ENSMUSG00000022595
AA Change: A29E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LU 23 114 1.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188716
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Lypd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03010:Lypd2 APN 15 74734253 missense probably benign 0.00
R2340:Lypd2 UTSW 15 74734254 missense probably benign
R5124:Lypd2 UTSW 15 74732498 missense probably benign 0.21
R5493:Lypd2 UTSW 15 74734278 missense probably benign 0.01
R7209:Lypd2 UTSW 15 74732417 missense probably benign 0.22
R7363:Lypd2 UTSW 15 74732999 missense probably damaging 1.00
R8119:Lypd2 UTSW 15 74733032 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGACAGAAAGTCTCTTGGCAG -3'
(R):5'- TCTCCCCTGAGCTTGGTTAG -3'

Sequencing Primer
(F):5'- AAGTCTCTTGGCAGAAATGGTG -3'
(R):5'- TAGTGGGCATCTGGTCCC -3'
Posted On2016-09-06