Incidental Mutation 'R5368:Gldc'
ID429506
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission 043204-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30158521 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 160 (S160P)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: S160P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: S160P

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080982
Meta Mutation Damage Score 0.1533 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTGGACTTTATGCAAATGGAAGGG -3'
(R):5'- TAGACTGTAAGCGGGGCTTC -3'

Sequencing Primer
(F):5'- TTCCCAATCAGAAGCCAG -3'
(R):5'- GGGGCTTCCTGCTGGGG -3'
Posted On2016-09-06