Incidental Mutation 'R5369:Snrnp40'
ID429529
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Namesmall nuclear ribonucleoprotein 40 (U5)
Synonyms0610009C03Rik, Wdr57
MMRRC Submission 042946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5369 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130360132-130390026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130362646 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 55 (S55P)
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994] [ENSMUST00000134159]
Predicted Effect probably damaging
Transcript: ENSMUST00000105994
AA Change: S55P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088
AA Change: S55P

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134159
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181161
Meta Mutation Damage Score 0.1967 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,033,006 R131S probably benign Het
A2ml1 T C 6: 128,568,833 T444A probably damaging Het
A330070K13Rik G A 5: 130,379,091 probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acbd5 T A 2: 23,112,510 L508Q probably damaging Het
Asb15 T C 6: 24,562,564 V175A probably benign Het
B3galnt2 T C 13: 13,994,425 probably null Het
BC024139 A C 15: 76,120,222 S711R probably benign Het
Bod1l A G 5: 41,827,183 I508T probably damaging Het
Btnl6 T A 17: 34,507,985 R524* probably null Het
C3 C A 17: 57,221,159 D687Y probably benign Het
Ccbe1 G A 18: 66,061,414 A367V probably benign Het
Ccr1 A T 9: 123,964,289 M68K probably damaging Het
Cd27 T A 6: 125,234,364 probably benign Het
Celf2 C A 2: 7,081,081 probably benign Het
Cfap54 T C 10: 93,061,257 probably benign Het
Cfap97 A G 8: 46,169,650 K26E probably damaging Het
Clcn4 T A 7: 7,296,033 I48F probably benign Het
Cnot7 A T 8: 40,494,020 N238K probably benign Het
Colec12 A G 18: 9,866,750 I654V unknown Het
Dip2a A G 10: 76,292,360 I22T probably damaging Het
Eif4g3 C T 4: 138,183,334 T1375M possibly damaging Het
Eml5 C T 12: 98,858,783 G725D probably damaging Het
F12 T C 13: 55,418,491 E496G probably benign Het
Fam227a A T 15: 79,615,436 S573T probably benign Het
Fnip1 T C 11: 54,502,589 V593A probably benign Het
Focad T A 4: 88,121,373 probably benign Het
Frem1 A G 4: 83,001,739 I460T possibly damaging Het
Galnt10 T G 11: 57,765,747 probably null Het
Gm5592 A T 7: 41,218,211 probably benign Het
Gm6185 A T 1: 161,209,760 noncoding transcript Het
Gm7935 A T 15: 74,081,114 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Gstm5 G A 3: 107,898,466 A198T probably damaging Het
Herc2 T A 7: 56,182,700 V3048D probably damaging Het
Htra4 T G 8: 25,033,569 I327L possibly damaging Het
Ifi209 T C 1: 173,637,307 M1T probably null Het
Ints6 T C 14: 62,743,935 T135A probably damaging Het
Itpr1 T A 6: 108,519,424 I2604N probably damaging Het
Krt6a T A 15: 101,692,558 M268L probably benign Het
Lrp1b G T 2: 41,004,613 S2201* probably null Het
Lrp2 T C 2: 69,459,560 N3645S probably benign Het
Lrrc15 A T 16: 30,272,904 I539N possibly damaging Het
Map3k6 T C 4: 133,247,681 I675T probably damaging Het
Map3k9 T A 12: 81,722,052 E1074V probably damaging Het
Med13l T A 5: 118,724,010 S339R probably benign Het
Mrps18a T C 17: 46,125,626 probably benign Het
Nat8f2 G T 6: 85,867,872 Y169* probably null Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Npc1l1 A G 11: 6,217,705 probably null Het
Olfr202 A T 16: 59,284,380 M39K probably damaging Het
Olfr419 A G 1: 174,250,441 V162A probably damaging Het
Ostf1 C T 19: 18,581,325 G198E probably benign Het
Pcsk5 A G 19: 17,581,255 V596A probably damaging Het
Pde4c T C 8: 70,750,105 *647Q probably null Het
Pkm A T 9: 59,670,634 I245F probably damaging Het
Ptprj T C 2: 90,469,641 H179R probably benign Het
Rapgef2 A T 3: 79,069,432 S1356T probably benign Het
Rbm45 T A 2: 76,370,250 L41Q probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scel A T 14: 103,586,493 I386F probably benign Het
Serpinb5 A T 1: 106,881,757 N298Y possibly damaging Het
Sirt3 A T 7: 140,869,493 L180Q probably damaging Het
Slc24a2 C T 4: 86,991,388 V698I probably damaging Het
Slc43a3 A T 2: 84,957,723 H483L probably damaging Het
Snrnp35 A G 5: 124,490,199 D25G probably benign Het
Snx9 T A 17: 5,920,580 C399S probably damaging Het
Soga1 T C 2: 157,040,734 E466G probably damaging Het
Ttbk2 T C 2: 120,825,262 probably benign Het
Vmn1r1 A G 1: 182,157,776 V108A possibly damaging Het
Vmn1r201 T A 13: 22,475,502 N295K probably benign Het
Zfp292 G A 4: 34,807,491 P1851L possibly damaging Het
Zfp472 A T 17: 32,977,743 D264V probably damaging Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0372:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0486:Snrnp40 UTSW 4 130378043 splice site probably null
R0488:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0650:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1305:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5699:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTCCAAGGGATTGTCAGAGAG -3'
(R):5'- ACACATGCCCTGCTTTAGC -3'

Sequencing Primer
(F):5'- GTCCAAGGGATTGTCAGAGAGTTCTG -3'
(R):5'- TCTGAGGATTTCTATGGCACTC -3'
Posted On2016-09-06