Mutagenetix > Incidental Mutation

Incidental Mutation 'R5369:Bod1l'

429533

Institutional Source

Beutler Lab

Gene Symbol

Bod1l

Ensembl Gene

ENSMUSG00000061755

Gene Name

biorientation of chromosomes in cell division 1-like

Synonyms

A230054D04Rik

MMRRC Submission

042946-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R5369 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41787538-41844315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41827183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 508 (I508T)

Ref Sequence

ENSEMBL: ENSMUSP00000144359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000050556
AA Change: I508T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: I508T

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	1.8e-28	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	3.21e-1	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202200

Predicted Effect

probably damaging
Transcript: ENSMUST00000202908
AA Change: I508T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: I508T

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	2.9e-24	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	1.9e-3	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Meta Mutation Damage Score

0.0623

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	T	A	6: 41,033,006	R131S	probably benign	Het
A2ml1	T	C	6: 128,568,833	T444A	probably damaging	Het
A330070K13Rik	G	A	5: 130,379,091		probably benign	Het
Abcb8	C	T	5: 24,400,139	R108C	possibly damaging	Het
Acbd5	T	A	2: 23,112,510	L508Q	probably damaging	Het
Asb15	T	C	6: 24,562,564	V175A	probably benign	Het
B3galnt2	T	C	13: 13,994,425		probably null	Het
BC024139	A	C	15: 76,120,222	S711R	probably benign	Het
Btnl6	T	A	17: 34,507,985	R524*	probably null	Het
C3	C	A	17: 57,221,159	D687Y	probably benign	Het
Ccbe1	G	A	18: 66,061,414	A367V	probably benign	Het
Ccr1	A	T	9: 123,964,289	M68K	probably damaging	Het
Cd27	T	A	6: 125,234,364		probably benign	Het
Celf2	C	A	2: 7,081,081		probably benign	Het
Cfap54	T	C	10: 93,061,257		probably benign	Het
Cfap97	A	G	8: 46,169,650	K26E	probably damaging	Het
Clcn4	T	A	7: 7,296,033	I48F	probably benign	Het
Cnot7	A	T	8: 40,494,020	N238K	probably benign	Het
Colec12	A	G	18: 9,866,750	I654V	unknown	Het
Dip2a	A	G	10: 76,292,360	I22T	probably damaging	Het
Eif4g3	C	T	4: 138,183,334	T1375M	possibly damaging	Het
Eml5	C	T	12: 98,858,783	G725D	probably damaging	Het
F12	T	C	13: 55,418,491	E496G	probably benign	Het
Fam227a	A	T	15: 79,615,436	S573T	probably benign	Het
Fnip1	T	C	11: 54,502,589	V593A	probably benign	Het
Focad	T	A	4: 88,121,373		probably benign	Het
Frem1	A	G	4: 83,001,739	I460T	possibly damaging	Het
Galnt10	T	G	11: 57,765,747		probably null	Het
Gm5592	A	T	7: 41,218,211		probably benign	Het
Gm6185	A	T	1: 161,209,760		noncoding transcript	Het
Gm7935	A	T	15: 74,081,114		noncoding transcript	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Gstm5	G	A	3: 107,898,466	A198T	probably damaging	Het
Herc2	T	A	7: 56,182,700	V3048D	probably damaging	Het
Htra4	T	G	8: 25,033,569	I327L	possibly damaging	Het
Ifi209	T	C	1: 173,637,307	M1T	probably null	Het
Ints6	T	C	14: 62,743,935	T135A	probably damaging	Het
Itpr1	T	A	6: 108,519,424	I2604N	probably damaging	Het
Krt6a	T	A	15: 101,692,558	M268L	probably benign	Het
Lrp1b	G	T	2: 41,004,613	S2201*	probably null	Het
Lrp2	T	C	2: 69,459,560	N3645S	probably benign	Het
Lrrc15	A	T	16: 30,272,904	I539N	possibly damaging	Het
Map3k6	T	C	4: 133,247,681	I675T	probably damaging	Het
Map3k9	T	A	12: 81,722,052	E1074V	probably damaging	Het
Med13l	T	A	5: 118,724,010	S339R	probably benign	Het
Mrps18a	T	C	17: 46,125,626		probably benign	Het
Nat8f2	G	T	6: 85,867,872	Y169*	probably null	Het
Nlrp1b	A	G	11: 71,181,799	I406T	probably benign	Het
Npc1l1	A	G	11: 6,217,705		probably null	Het
Olfr202	A	T	16: 59,284,380	M39K	probably damaging	Het
Olfr419	A	G	1: 174,250,441	V162A	probably damaging	Het
Ostf1	C	T	19: 18,581,325	G198E	probably benign	Het
Pcsk5	A	G	19: 17,581,255	V596A	probably damaging	Het
Pde4c	T	C	8: 70,750,105	*647Q	probably null	Het
Pkm	A	T	9: 59,670,634	I245F	probably damaging	Het
Ptprj	T	C	2: 90,469,641	H179R	probably benign	Het
Rapgef2	A	T	3: 79,069,432	S1356T	probably benign	Het
Rbm45	T	A	2: 76,370,250	L41Q	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Scel	A	T	14: 103,586,493	I386F	probably benign	Het
Serpinb5	A	T	1: 106,881,757	N298Y	possibly damaging	Het
Sirt3	A	T	7: 140,869,493	L180Q	probably damaging	Het
Slc24a2	C	T	4: 86,991,388	V698I	probably damaging	Het
Slc43a3	A	T	2: 84,957,723	H483L	probably damaging	Het
Snrnp35	A	G	5: 124,490,199	D25G	probably benign	Het
Snrnp40	T	C	4: 130,362,646	S55P	probably damaging	Het
Snx9	T	A	17: 5,920,580	C399S	probably damaging	Het
Soga1	T	C	2: 157,040,734	E466G	probably damaging	Het
Ttbk2	T	C	2: 120,825,262		probably benign	Het
Vmn1r1	A	G	1: 182,157,776	V108A	possibly damaging	Het
Vmn1r201	T	A	13: 22,475,502	N295K	probably benign	Het
Zfp292	G	A	4: 34,807,491	P1851L	possibly damaging	Het
Zfp472	A	T	17: 32,977,743	D264V	probably damaging	Het

Other mutations in Bod1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Bod1l	APN	5	41816823	missense	probably benign	0.00
IGL00990:Bod1l	APN	5	41828865	missense	probably benign	0.00
IGL01021:Bod1l	APN	5	41838173	splice site	probably benign
IGL01022:Bod1l	APN	5	41794309	missense	probably damaging	1.00
IGL01303:Bod1l	APN	5	41817599	missense	probably benign	0.00
IGL01654:Bod1l	APN	5	41818176	missense	probably damaging	0.99
IGL01748:Bod1l	APN	5	41816961	missense	probably benign	0.23
IGL01758:Bod1l	APN	5	41826610	splice site	probably benign
IGL01783:Bod1l	APN	5	41808712	missense	probably benign	0.02
IGL01790:Bod1l	APN	5	41832250	missense	probably benign	0.14
IGL01803:Bod1l	APN	5	41817389	missense	probably damaging	0.97
IGL01829:Bod1l	APN	5	41820468	missense	probably benign	0.25
IGL01952:Bod1l	APN	5	41816954	missense	possibly damaging	0.70
IGL02005:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02110:Bod1l	APN	5	41816453	missense	probably damaging	0.97
IGL02129:Bod1l	APN	5	41821850	missense	probably benign	0.36
IGL02572:Bod1l	APN	5	41821230	nonsense	probably null
IGL02583:Bod1l	APN	5	41816207	critical splice donor site	probably null
IGL02643:Bod1l	APN	5	41818805	missense	possibly damaging	0.65
IGL02714:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02728:Bod1l	APN	5	41826503	missense	probably damaging	1.00
IGL02752:Bod1l	APN	5	41816463	missense	possibly damaging	0.58
IGL02822:Bod1l	APN	5	41794345	missense	possibly damaging	0.94
IGL03032:Bod1l	APN	5	41831584	missense	probably benign	0.16
IGL03372:Bod1l	APN	5	41805235	splice site	probably benign
capacitance	UTSW	5	41791813	missense	possibly damaging	0.91
gauss	UTSW	5	41816867	missense	probably benign	0.01
Tesla	UTSW	5	41795068	critical splice donor site	probably null
R0102:Bod1l	UTSW	5	41817269	missense	probably benign	0.36
R0147:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0148:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0490:Bod1l	UTSW	5	41821892	missense	probably damaging	0.96
R0577:Bod1l	UTSW	5	41794887	missense	probably damaging	1.00
R0587:Bod1l	UTSW	5	41821637	missense	probably benign	0.16
R0620:Bod1l	UTSW	5	41801233	missense	probably benign	0.16
R0626:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R0785:Bod1l	UTSW	5	41820016	missense	probably benign	0.00
R1139:Bod1l	UTSW	5	41831471	missense	possibly damaging	0.64
R1165:Bod1l	UTSW	5	41821053	missense	probably benign	0.02
R1418:Bod1l	UTSW	5	41819471	missense	probably damaging	1.00
R1509:Bod1l	UTSW	5	41819540	missense	probably damaging	0.99
R1533:Bod1l	UTSW	5	41822155	nonsense	probably null
R1538:Bod1l	UTSW	5	41816429	missense	probably benign	0.00
R1591:Bod1l	UTSW	5	41819220	missense	probably benign	0.06
R1616:Bod1l	UTSW	5	41808715	missense	probably benign
R1628:Bod1l	UTSW	5	41816982	missense	probably benign	0.01
R1667:Bod1l	UTSW	5	41816775	missense	probably benign	0.01
R1869:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1870:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1993:Bod1l	UTSW	5	41817336	missense	probably damaging	1.00
R2060:Bod1l	UTSW	5	41808742	missense	possibly damaging	0.58
R2066:Bod1l	UTSW	5	41805156	missense	probably damaging	0.99
R2067:Bod1l	UTSW	5	41817086	missense	probably benign	0.11
R2073:Bod1l	UTSW	5	41819189	missense	probably benign	0.19
R2092:Bod1l	UTSW	5	41831517	missense	probably damaging	1.00
R2105:Bod1l	UTSW	5	41832279	missense	probably benign	0.00
R2243:Bod1l	UTSW	5	41821545	missense	possibly damaging	0.58
R2322:Bod1l	UTSW	5	41827120	missense	probably benign	0.09
R2849:Bod1l	UTSW	5	41838076	missense	probably damaging	1.00
R2883:Bod1l	UTSW	5	41832259	missense	probably benign	0.03
R3037:Bod1l	UTSW	5	41822037	missense	probably damaging	0.99
R3910:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3911:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3962:Bod1l	UTSW	5	41808721	missense	probably benign	0.07
R4235:Bod1l	UTSW	5	41821455	missense	probably damaging	1.00
R4308:Bod1l	UTSW	5	41791813	missense	possibly damaging	0.91
R4414:Bod1l	UTSW	5	41820527	missense	probably benign	0.04
R4535:Bod1l	UTSW	5	41832231	missense	probably benign	0.06
R4631:Bod1l	UTSW	5	41817735	missense	probably damaging	1.00
R4657:Bod1l	UTSW	5	41818612	missense	probably benign	0.00
R4782:Bod1l	UTSW	5	41833663	missense	probably benign	0.06
R4786:Bod1l	UTSW	5	41819438	missense	probably benign	0.43
R4840:Bod1l	UTSW	5	41818472	missense	probably damaging	1.00
R4877:Bod1l	UTSW	5	41819994	missense	probably benign	0.00
R4982:Bod1l	UTSW	5	41820473	missense	probably benign	0.00
R5152:Bod1l	UTSW	5	41816543	missense	probably benign	0.04
R5284:Bod1l	UTSW	5	41820467	missense	probably benign	0.05
R5354:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R5486:Bod1l	UTSW	5	41807181	missense	possibly damaging	0.56
R5541:Bod1l	UTSW	5	41791933	missense	probably benign	0.06
R5610:Bod1l	UTSW	5	41821874	missense	probably damaging	1.00
R5655:Bod1l	UTSW	5	41817044	missense	probably benign	0.06
R5705:Bod1l	UTSW	5	41817002	missense	probably benign	0.01
R5819:Bod1l	UTSW	5	41832605	missense	probably benign	0.27
R5890:Bod1l	UTSW	5	41820578	missense	probably benign	0.43
R5923:Bod1l	UTSW	5	41817419	missense	probably damaging	1.00
R5991:Bod1l	UTSW	5	41816863	nonsense	probably null
R6017:Bod1l	UTSW	5	41818760	missense	probably benign	0.01
R6253:Bod1l	UTSW	5	41826538	missense	probably damaging	0.96
R6284:Bod1l	UTSW	5	41818787	missense	probably benign	0.35
R6483:Bod1l	UTSW	5	41821082	missense	probably benign	0.03
R6485:Bod1l	UTSW	5	41817116	missense	possibly damaging	0.93
R6575:Bod1l	UTSW	5	41838068	missense	probably damaging	1.00
R6679:Bod1l	UTSW	5	41816666	missense	probably damaging	0.97
R6788:Bod1l	UTSW	5	41821873	nonsense	probably null
R7006:Bod1l	UTSW	5	41832552	missense	probably damaging	1.00
R7095:Bod1l	UTSW	5	41795068	critical splice donor site	probably null
R7111:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7190:Bod1l	UTSW	5	41819938	missense	probably benign	0.14
R7311:Bod1l	UTSW	5	41794333	missense	possibly damaging	0.57
R7336:Bod1l	UTSW	5	41821524	missense	probably damaging	1.00
R7341:Bod1l	UTSW	5	41788857	missense	probably benign	0.00
R7396:Bod1l	UTSW	5	41831546	missense	probably damaging	1.00
R7431:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7442:Bod1l	UTSW	5	41807179	missense	probably damaging	0.96
R7539:Bod1l	UTSW	5	41817860	missense	possibly damaging	0.65
R7583:Bod1l	UTSW	5	41833790	missense	probably damaging	1.00
R7679:Bod1l	UTSW	5	41820643	frame shift	probably null
R7748:Bod1l	UTSW	5	41832340	missense	probably damaging	0.97
R7767:Bod1l	UTSW	5	41816756	missense	probably benign	0.01
R7773:Bod1l	UTSW	5	41832712	missense	probably benign	0.14
R7782:Bod1l	UTSW	5	41817943	missense	probably benign	0.01
R7860:Bod1l	UTSW	5	41819265	missense	probably damaging	1.00
R7975:Bod1l	UTSW	5	41816277	missense	possibly damaging	0.90
R7977:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R7987:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R8104:Bod1l	UTSW	5	41833732	nonsense	probably null
R8217:Bod1l	UTSW	5	41831507	missense	probably damaging	1.00
R8307:Bod1l	UTSW	5	41821155	missense	probably damaging	1.00
R8469:Bod1l	UTSW	5	41821491	missense	possibly damaging	0.86
R8506:Bod1l	UTSW	5	41819055	nonsense	probably null
R8934:Bod1l	UTSW	5	41819601	missense	probably benign	0.11
R8984:Bod1l	UTSW	5	41788872	missense	probably damaging	1.00
R8989:Bod1l	UTSW	5	41821682	missense	probably benign	0.00
R8993:Bod1l	UTSW	5	41816867	missense	probably benign	0.01
R9128:Bod1l	UTSW	5	41788923	missense	probably benign	0.22
R9129:Bod1l	UTSW	5	41818877	missense	probably damaging	0.99
R9198:Bod1l	UTSW	5	41799786	missense	probably benign	0.08
R9254:Bod1l	UTSW	5	41821880	missense	probably damaging	1.00
R9445:Bod1l	UTSW	5	41817276	missense	probably benign	0.04
R9457:Bod1l	UTSW	5	41821967	missense	probably damaging	0.99
R9470:Bod1l	UTSW	5	41817096	missense	probably damaging	0.99
R9536:Bod1l	UTSW	5	41816962	missense	probably benign	0.01
R9654:Bod1l	UTSW	5	41818364	missense	probably benign	0.02
R9734:Bod1l	UTSW	5	41805230	missense	possibly damaging	0.91
R9771:Bod1l	UTSW	5	41791863	missense	probably damaging	0.96
X0027:Bod1l	UTSW	5	41832669	missense	probably benign	0.20
X0058:Bod1l	UTSW	5	41824018	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41808764	missense	possibly damaging	0.95
Z1088:Bod1l	UTSW	5	41821146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCACCAGTAGAGCAGGATAAATTC -3'
(R):5'- CCAAGGTCTCACTCAAGTGTG -3'

Sequencing Primer
(F):5'- GCAGGATAAATTCTTCCACACTTAGG -3'
(R):5'- GTGTGCTGAGCCAGATCAATACC -3'

Posted On

2016-09-06