Mutagenetix > Incidental Mutation

Incidental Mutation 'R5369:A2ml1'

429543

Institutional Source

Beutler Lab

Gene Symbol

A2ml1

Ensembl Gene

ENSMUSG00000047228

Gene Name

alpha-2-macroglobulin like 1

Synonyms

MMRRC Submission

042946-MU

Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5369 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128539821-128581608 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128568833 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 444 (T444A)

Ref Sequence

ENSEMBL: ENSMUSP00000059426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060574]

AlphaFold

Q3UU35

Predicted Effect

probably damaging
Transcript: ENSMUST00000060574
AA Change: T444A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: T444A

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
Pfam:A2M_N	120	213	6.3e-17	PFAM
A2M_N_2	448	594	2.95e-37	SMART
A2M	736	826	2.11e-33	SMART
Pfam:Thiol-ester_cl	959	988	3.1e-17	PFAM
Pfam:A2M_comp	1008	1255	2.3e-71	PFAM
A2M_recep	1361	1447	1.22e-29	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	T	A	6: 41,033,006	R131S	probably benign	Het
A330070K13Rik	G	A	5: 130,379,091		probably benign	Het
Abcb8	C	T	5: 24,400,139	R108C	possibly damaging	Het
Acbd5	T	A	2: 23,112,510	L508Q	probably damaging	Het
Asb15	T	C	6: 24,562,564	V175A	probably benign	Het
B3galnt2	T	C	13: 13,994,425		probably null	Het
BC024139	A	C	15: 76,120,222	S711R	probably benign	Het
Bod1l	A	G	5: 41,827,183	I508T	probably damaging	Het
Btnl6	T	A	17: 34,507,985	R524*	probably null	Het
C3	C	A	17: 57,221,159	D687Y	probably benign	Het
Ccbe1	G	A	18: 66,061,414	A367V	probably benign	Het
Ccr1	A	T	9: 123,964,289	M68K	probably damaging	Het
Cd27	T	A	6: 125,234,364		probably benign	Het
Celf2	C	A	2: 7,081,081		probably benign	Het
Cfap54	T	C	10: 93,061,257		probably benign	Het
Cfap97	A	G	8: 46,169,650	K26E	probably damaging	Het
Clcn4	T	A	7: 7,296,033	I48F	probably benign	Het
Cnot7	A	T	8: 40,494,020	N238K	probably benign	Het
Colec12	A	G	18: 9,866,750	I654V	unknown	Het
Dip2a	A	G	10: 76,292,360	I22T	probably damaging	Het
Eif4g3	C	T	4: 138,183,334	T1375M	possibly damaging	Het
Eml5	C	T	12: 98,858,783	G725D	probably damaging	Het
F12	T	C	13: 55,418,491	E496G	probably benign	Het
Fam227a	A	T	15: 79,615,436	S573T	probably benign	Het
Fnip1	T	C	11: 54,502,589	V593A	probably benign	Het
Focad	T	A	4: 88,121,373		probably benign	Het
Frem1	A	G	4: 83,001,739	I460T	possibly damaging	Het
Galnt10	T	G	11: 57,765,747		probably null	Het
Gm5592	A	T	7: 41,218,211		probably benign	Het
Gm6185	A	T	1: 161,209,760		noncoding transcript	Het
Gm7935	A	T	15: 74,081,114		noncoding transcript	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Gstm5	G	A	3: 107,898,466	A198T	probably damaging	Het
Herc2	T	A	7: 56,182,700	V3048D	probably damaging	Het
Htra4	T	G	8: 25,033,569	I327L	possibly damaging	Het
Ifi209	T	C	1: 173,637,307	M1T	probably null	Het
Ints6	T	C	14: 62,743,935	T135A	probably damaging	Het
Itpr1	T	A	6: 108,519,424	I2604N	probably damaging	Het
Krt6a	T	A	15: 101,692,558	M268L	probably benign	Het
Lrp1b	G	T	2: 41,004,613	S2201*	probably null	Het
Lrp2	T	C	2: 69,459,560	N3645S	probably benign	Het
Lrrc15	A	T	16: 30,272,904	I539N	possibly damaging	Het
Map3k6	T	C	4: 133,247,681	I675T	probably damaging	Het
Map3k9	T	A	12: 81,722,052	E1074V	probably damaging	Het
Med13l	T	A	5: 118,724,010	S339R	probably benign	Het
Mrps18a	T	C	17: 46,125,626		probably benign	Het
Nat8f2	G	T	6: 85,867,872	Y169*	probably null	Het
Nlrp1b	A	G	11: 71,181,799	I406T	probably benign	Het
Npc1l1	A	G	11: 6,217,705		probably null	Het
Olfr202	A	T	16: 59,284,380	M39K	probably damaging	Het
Olfr419	A	G	1: 174,250,441	V162A	probably damaging	Het
Ostf1	C	T	19: 18,581,325	G198E	probably benign	Het
Pcsk5	A	G	19: 17,581,255	V596A	probably damaging	Het
Pde4c	T	C	8: 70,750,105	*647Q	probably null	Het
Pkm	A	T	9: 59,670,634	I245F	probably damaging	Het
Ptprj	T	C	2: 90,469,641	H179R	probably benign	Het
Rapgef2	A	T	3: 79,069,432	S1356T	probably benign	Het
Rbm45	T	A	2: 76,370,250	L41Q	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Scel	A	T	14: 103,586,493	I386F	probably benign	Het
Serpinb5	A	T	1: 106,881,757	N298Y	possibly damaging	Het
Sirt3	A	T	7: 140,869,493	L180Q	probably damaging	Het
Slc24a2	C	T	4: 86,991,388	V698I	probably damaging	Het
Slc43a3	A	T	2: 84,957,723	H483L	probably damaging	Het
Snrnp35	A	G	5: 124,490,199	D25G	probably benign	Het
Snrnp40	T	C	4: 130,362,646	S55P	probably damaging	Het
Snx9	T	A	17: 5,920,580	C399S	probably damaging	Het
Soga1	T	C	2: 157,040,734	E466G	probably damaging	Het
Ttbk2	T	C	2: 120,825,262		probably benign	Het
Vmn1r1	A	G	1: 182,157,776	V108A	possibly damaging	Het
Vmn1r201	T	A	13: 22,475,502	N295K	probably benign	Het
Zfp292	G	A	4: 34,807,491	P1851L	possibly damaging	Het
Zfp472	A	T	17: 32,977,743	D264V	probably damaging	Het

Other mutations in A2ml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:A2ml1	APN	6	128578156	missense	possibly damaging	0.78
IGL00596:A2ml1	APN	6	128570067	missense	probably damaging	0.99
IGL00912:A2ml1	APN	6	128552307	missense	probably benign	0.04
IGL01320:A2ml1	APN	6	128575588	missense	probably benign	0.00
IGL01470:A2ml1	APN	6	128580412	missense	probably damaging	0.96
IGL01576:A2ml1	APN	6	128554330	splice site	probably benign
IGL01761:A2ml1	APN	6	128546337	missense	possibly damaging	0.61
IGL01792:A2ml1	APN	6	128560679	missense	probably benign	0.04
IGL01843:A2ml1	APN	6	128553338	splice site	probably benign
IGL01946:A2ml1	APN	6	128570479	missense	possibly damaging	0.81
IGL02016:A2ml1	APN	6	128558335	missense	probably damaging	1.00
IGL02170:A2ml1	APN	6	128547210	missense	possibly damaging	0.58
IGL02269:A2ml1	APN	6	128553338	splice site	probably benign
IGL02589:A2ml1	APN	6	128581500	missense	probably benign	0.00
IGL02959:A2ml1	APN	6	128567060	missense	probably benign	0.04
IGL02970:A2ml1	APN	6	128569979	missense	probably damaging	1.00
IGL03206:A2ml1	APN	6	128553276	missense	possibly damaging	0.50
IGL03298:A2ml1	APN	6	128543960	missense	probably benign	0.00
1mM(1):A2ml1	UTSW	6	128580960	missense	probably benign	0.02
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0128:A2ml1	UTSW	6	128575639	splice site	probably benign
R0299:A2ml1	UTSW	6	128553232	splice site	probably benign
R0523:A2ml1	UTSW	6	128558326	missense	possibly damaging	0.92
R0565:A2ml1	UTSW	6	128568743	nonsense	probably null
R0599:A2ml1	UTSW	6	128552245	missense	probably damaging	1.00
R0626:A2ml1	UTSW	6	128550773	missense	probably damaging	0.99
R0732:A2ml1	UTSW	6	128546448	missense	probably damaging	1.00
R0880:A2ml1	UTSW	6	128560646	missense	possibly damaging	0.49
R1070:A2ml1	UTSW	6	128543300	missense	probably damaging	1.00
R1166:A2ml1	UTSW	6	128570917	missense	probably benign	0.00
R1278:A2ml1	UTSW	6	128558507	missense	probably damaging	1.00
R1421:A2ml1	UTSW	6	128543960	missense	probably benign	0.00
R1536:A2ml1	UTSW	6	128547233	nonsense	probably null
R1786:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R1808:A2ml1	UTSW	6	128543299	missense	probably damaging	1.00
R1813:A2ml1	UTSW	6	128566273	missense	probably benign	0.34
R1863:A2ml1	UTSW	6	128550783	missense	probably damaging	0.99
R2007:A2ml1	UTSW	6	128542892	missense	probably benign	0.13
R2062:A2ml1	UTSW	6	128552308	missense	probably benign	0.08
R2127:A2ml1	UTSW	6	128558437	missense	probably damaging	1.00
R2130:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2131:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2201:A2ml1	UTSW	6	128547305	missense	probably null	0.34
R2319:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2321:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2322:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2369:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2370:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2371:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2372:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2375:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2893:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2894:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3438:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3615:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3616:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3773:A2ml1	UTSW	6	128555083	missense	probably benign	0.02
R3785:A2ml1	UTSW	6	128544924	critical splice donor site	probably null
R3803:A2ml1	UTSW	6	128545070	missense	probably benign	0.17
R3824:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R3878:A2ml1	UTSW	6	128554361	missense	probably benign	0.05
R4176:A2ml1	UTSW	6	128545037	missense	possibly damaging	0.68
R4229:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4230:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4348:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4351:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4352:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4353:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4427:A2ml1	UTSW	6	128545046	missense	probably benign	0.00
R4971:A2ml1	UTSW	6	128547227	missense	probably damaging	0.98
R5014:A2ml1	UTSW	6	128543933	missense	probably benign	0.00
R5532:A2ml1	UTSW	6	128553330	critical splice acceptor site	probably null
R5860:A2ml1	UTSW	6	128541061	missense	probably benign	0.15
R5872:A2ml1	UTSW	6	128561526	missense	probably damaging	1.00
R5926:A2ml1	UTSW	6	128560645	missense	probably benign
R5977:A2ml1	UTSW	6	128581122	missense	probably damaging	1.00
R5980:A2ml1	UTSW	6	128567055	missense	possibly damaging	0.82
R6014:A2ml1	UTSW	6	128571985	missense	probably damaging	1.00
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6061:A2ml1	UTSW	6	128568712	missense	probably damaging	1.00
R6327:A2ml1	UTSW	6	128558692	splice site	probably null
R6331:A2ml1	UTSW	6	128552236	missense	probably damaging	0.96
R6465:A2ml1	UTSW	6	128541078	missense	probably damaging	1.00
R6640:A2ml1	UTSW	6	128553285	missense	probably benign	0.41
R6792:A2ml1	UTSW	6	128546329	nonsense	probably null
R6793:A2ml1	UTSW	6	128546329	nonsense	probably null
R7207:A2ml1	UTSW	6	128550771	missense	probably benign	0.04
R7378:A2ml1	UTSW	6	128546247	critical splice donor site	probably null
R7556:A2ml1	UTSW	6	128569964	missense	probably damaging	1.00
R8010:A2ml1	UTSW	6	128580340	missense	probably benign	0.08
R8017:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8019:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8035:A2ml1	UTSW	6	128553280	missense	probably damaging	0.99
R8094:A2ml1	UTSW	6	128572082	missense	probably damaging	1.00
R8144:A2ml1	UTSW	6	128569999	missense	possibly damaging	0.84
R8365:A2ml1	UTSW	6	128580955	nonsense	probably null
R8382:A2ml1	UTSW	6	128560682	missense	probably benign	0.01
R8388:A2ml1	UTSW	6	128571974	missense	probably benign	0.03
R8717:A2ml1	UTSW	6	128566995	missense	probably benign	0.00
R8947:A2ml1	UTSW	6	128552256	missense	probably damaging	1.00
R8970:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R9025:A2ml1	UTSW	6	128557582	missense	possibly damaging	0.49
R9083:A2ml1	UTSW	6	128557561	missense	possibly damaging	0.90
R9129:A2ml1	UTSW	6	128546260	missense	probably damaging	1.00
R9145:A2ml1	UTSW	6	128559069	missense	probably benign
R9165:A2ml1	UTSW	6	128560669	missense	probably benign
R9285:A2ml1	UTSW	6	128549793	missense	probably benign
R9408:A2ml1	UTSW	6	128545067	missense	probably damaging	0.98
R9486:A2ml1	UTSW	6	128569979	missense	probably damaging	0.99
R9781:A2ml1	UTSW	6	128542897	missense	probably benign	0.01
RF014:A2ml1	UTSW	6	128570068	missense	probably damaging	0.96
X0063:A2ml1	UTSW	6	128572012	missense	probably benign
Z1176:A2ml1	UTSW	6	128571977	missense	probably benign	0.09
Z1177:A2ml1	UTSW	6	128545076	missense	probably benign
Z1177:A2ml1	UTSW	6	128561616	nonsense	probably null
Z1177:A2ml1	UTSW	6	128575607	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GTGGAGCTCACTCAGATTGG -3'
(R):5'- GACAACCCTTGTGTCCAGTAGC -3'

Sequencing Primer
(F):5'- GATGACACCTCCTAAGCTGGACTG -3'
(R):5'- GTCCAGTAGCATTCCCTATCTTAGAG -3'

Posted On

2016-09-06