Mutagenetix > Incidental Mutation

Incidental Mutation 'R5369:Herc2'

429546

Institutional Source

Beutler Lab

Gene Symbol

Herc2

Ensembl Gene

ENSMUSG00000030451

Gene Name

HECT and RLD domain containing E3 ubiquitin protein ligase 2

Synonyms

D7H15F37S1, D7H15F32S1, rjs, jdf2, D15F32S1h

MMRRC Submission

042946-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R5369 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56050196-56231800 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 56182700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 3048 (V3048D)

Ref Sequence

ENSEMBL: ENSMUSP00000145997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076226
AA Change: V3048D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451
AA Change: V3048D

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	198	212	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	304	317	N/A	INTRINSIC
Pfam:RCC1	514	567	7.6e-16	PFAM
Pfam:RCC1_2	554	583	6e-9	PFAM
Pfam:RCC1	570	615	7.1e-17	PFAM
Pfam:RCC1_2	606	637	6.9e-8	PFAM
Pfam:RCC1	624	673	7.2e-15	PFAM
Pfam:RCC1	676	725	3.3e-18	PFAM
Pfam:RCC1_2	712	740	1.6e-9	PFAM
low complexity region	854	866	N/A	INTRINSIC
low complexity region	902	913	N/A	INTRINSIC
coiled coil region	950	977	N/A	INTRINSIC
low complexity region	1052	1066	N/A	INTRINSIC
Cyt-b5	1211	1284	1.08e-1	SMART
low complexity region	1310	1316	N/A	INTRINSIC
low complexity region	1440	1446	N/A	INTRINSIC
low complexity region	1545	1563	N/A	INTRINSIC
coiled coil region	1651	1674	N/A	INTRINSIC
Pfam:MIB_HERC2	1871	1933	5.8e-29	PFAM
low complexity region	1939	1952	N/A	INTRINSIC
low complexity region	2211	2222	N/A	INTRINSIC
low complexity region	2381	2388	N/A	INTRINSIC
low complexity region	2402	2416	N/A	INTRINSIC
low complexity region	2521	2540	N/A	INTRINSIC
Pfam:Cul7	2555	2633	2.6e-43	PFAM
ZnF_ZZ	2703	2747	5.39e-11	SMART
APC10	2780	2933	5.1e-41	SMART
TECPR	2978	3019	7.59e0	SMART
Pfam:RCC1_2	3048	3079	9.2e-8	PFAM
Pfam:RCC1	3066	3115	3.7e-17	PFAM
Pfam:RCC1_2	3102	3131	3.9e-11	PFAM
Pfam:RCC1	3118	3162	1.9e-15	PFAM
Pfam:RCC1	3172	3221	9.6e-15	PFAM
Pfam:RCC1_2	3208	3236	2.2e-7	PFAM
TECPR	3241	3284	1.32e2	SMART
low complexity region	3357	3365	N/A	INTRINSIC
low complexity region	3430	3447	N/A	INTRINSIC
low complexity region	3480	3495	N/A	INTRINSIC
low complexity region	3755	3771	N/A	INTRINSIC
TECPR	3972	4012	2.41e1	SMART
Pfam:RCC1_2	4041	4072	5.1e-8	PFAM
Pfam:RCC1	4059	4108	1.5e-16	PFAM
Pfam:RCC1	4111	4155	7.9e-16	PFAM
TECPR	4184	4225	8.42e1	SMART
Pfam:RCC1_2	4253	4282	4.3e-10	PFAM
Pfam:RCC1	4269	4318	1.2e-17	PFAM
Blast:HECTc	4340	4425	6e-18	BLAST
HECTc	4455	4801	1.37e-62	SMART
low complexity region	4808	4828	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164095
AA Change: V3048D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451
AA Change: V3048D

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	198	212	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	304	317	N/A	INTRINSIC
Pfam:RCC1	514	567	2.9e-15	PFAM
Pfam:RCC1_2	554	583	1.6e-8	PFAM
Pfam:RCC1	570	615	2.3e-16	PFAM
Pfam:RCC1	624	673	1.2e-14	PFAM
Pfam:RCC1_2	660	689	2.1e-7	PFAM
Pfam:RCC1	676	725	9.8e-18	PFAM
Pfam:RCC1_2	712	740	1.1e-9	PFAM
low complexity region	854	866	N/A	INTRINSIC
low complexity region	902	913	N/A	INTRINSIC
coiled coil region	950	977	N/A	INTRINSIC
low complexity region	1052	1066	N/A	INTRINSIC
Cyt-b5	1211	1284	1.08e-1	SMART
low complexity region	1310	1316	N/A	INTRINSIC
low complexity region	1440	1446	N/A	INTRINSIC
low complexity region	1545	1563	N/A	INTRINSIC
coiled coil region	1651	1674	N/A	INTRINSIC
Pfam:MIB_HERC2	1871	1931	9.3e-25	PFAM
low complexity region	1939	1952	N/A	INTRINSIC
low complexity region	2211	2222	N/A	INTRINSIC
low complexity region	2381	2388	N/A	INTRINSIC
low complexity region	2402	2416	N/A	INTRINSIC
low complexity region	2521	2540	N/A	INTRINSIC
Pfam:Cul7	2555	2632	1.4e-39	PFAM
ZnF_ZZ	2703	2747	5.39e-11	SMART
APC10	2780	2933	5.1e-41	SMART
TECPR	2978	3019	7.59e0	SMART
Pfam:RCC1_2	3048	3079	1.6e-7	PFAM
Pfam:RCC1	3066	3115	7.1e-16	PFAM
Pfam:RCC1_2	3102	3131	7.1e-11	PFAM
Pfam:RCC1	3118	3163	1.2e-14	PFAM
Pfam:RCC1	3172	3221	4.7e-15	PFAM
TECPR	3241	3284	1.32e2	SMART
low complexity region	3357	3365	N/A	INTRINSIC
low complexity region	3430	3447	N/A	INTRINSIC
low complexity region	3480	3495	N/A	INTRINSIC
low complexity region	3755	3771	N/A	INTRINSIC
TECPR	3972	4012	2.41e1	SMART
Pfam:RCC1_2	4041	4072	1.2e-7	PFAM
Pfam:RCC1	4059	4108	9.6e-15	PFAM
Pfam:RCC1	4111	4156	5.6e-15	PFAM
TECPR	4184	4225	8.42e1	SMART
Pfam:RCC1_2	4253	4282	7.3e-10	PFAM
Pfam:RCC1	4269	4318	1.6e-16	PFAM
Blast:HECTc	4340	4425	6e-18	BLAST
HECTc	4455	4801	1.37e-62	SMART
low complexity region	4808	4828	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000205303
AA Change: V3048D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Meta Mutation Damage Score

0.8534

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	T	A	6: 41,033,006	R131S	probably benign	Het
A2ml1	T	C	6: 128,568,833	T444A	probably damaging	Het
A330070K13Rik	G	A	5: 130,379,091		probably benign	Het
Abcb8	C	T	5: 24,400,139	R108C	possibly damaging	Het
Acbd5	T	A	2: 23,112,510	L508Q	probably damaging	Het
Asb15	T	C	6: 24,562,564	V175A	probably benign	Het
B3galnt2	T	C	13: 13,994,425		probably null	Het
BC024139	A	C	15: 76,120,222	S711R	probably benign	Het
Bod1l	A	G	5: 41,827,183	I508T	probably damaging	Het
Btnl6	T	A	17: 34,507,985	R524*	probably null	Het
C3	C	A	17: 57,221,159	D687Y	probably benign	Het
Ccbe1	G	A	18: 66,061,414	A367V	probably benign	Het
Ccr1	A	T	9: 123,964,289	M68K	probably damaging	Het
Cd27	T	A	6: 125,234,364		probably benign	Het
Celf2	C	A	2: 7,081,081		probably benign	Het
Cfap54	T	C	10: 93,061,257		probably benign	Het
Cfap97	A	G	8: 46,169,650	K26E	probably damaging	Het
Clcn4	T	A	7: 7,296,033	I48F	probably benign	Het
Cnot7	A	T	8: 40,494,020	N238K	probably benign	Het
Colec12	A	G	18: 9,866,750	I654V	unknown	Het
Dip2a	A	G	10: 76,292,360	I22T	probably damaging	Het
Eif4g3	C	T	4: 138,183,334	T1375M	possibly damaging	Het
Eml5	C	T	12: 98,858,783	G725D	probably damaging	Het
F12	T	C	13: 55,418,491	E496G	probably benign	Het
Fam227a	A	T	15: 79,615,436	S573T	probably benign	Het
Fnip1	T	C	11: 54,502,589	V593A	probably benign	Het
Focad	T	A	4: 88,121,373		probably benign	Het
Frem1	A	G	4: 83,001,739	I460T	possibly damaging	Het
Galnt10	T	G	11: 57,765,747		probably null	Het
Gm5592	A	T	7: 41,218,211		probably benign	Het
Gm6185	A	T	1: 161,209,760		noncoding transcript	Het
Gm7935	A	T	15: 74,081,114		noncoding transcript	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Gstm5	G	A	3: 107,898,466	A198T	probably damaging	Het
Htra4	T	G	8: 25,033,569	I327L	possibly damaging	Het
Ifi209	T	C	1: 173,637,307	M1T	probably null	Het
Ints6	T	C	14: 62,743,935	T135A	probably damaging	Het
Itpr1	T	A	6: 108,519,424	I2604N	probably damaging	Het
Krt6a	T	A	15: 101,692,558	M268L	probably benign	Het
Lrp1b	G	T	2: 41,004,613	S2201*	probably null	Het
Lrp2	T	C	2: 69,459,560	N3645S	probably benign	Het
Lrrc15	A	T	16: 30,272,904	I539N	possibly damaging	Het
Map3k6	T	C	4: 133,247,681	I675T	probably damaging	Het
Map3k9	T	A	12: 81,722,052	E1074V	probably damaging	Het
Med13l	T	A	5: 118,724,010	S339R	probably benign	Het
Mrps18a	T	C	17: 46,125,626		probably benign	Het
Nat8f2	G	T	6: 85,867,872	Y169*	probably null	Het
Nlrp1b	A	G	11: 71,181,799	I406T	probably benign	Het
Npc1l1	A	G	11: 6,217,705		probably null	Het
Olfr202	A	T	16: 59,284,380	M39K	probably damaging	Het
Olfr419	A	G	1: 174,250,441	V162A	probably damaging	Het
Ostf1	C	T	19: 18,581,325	G198E	probably benign	Het
Pcsk5	A	G	19: 17,581,255	V596A	probably damaging	Het
Pde4c	T	C	8: 70,750,105	*647Q	probably null	Het
Pkm	A	T	9: 59,670,634	I245F	probably damaging	Het
Ptprj	T	C	2: 90,469,641	H179R	probably benign	Het
Rapgef2	A	T	3: 79,069,432	S1356T	probably benign	Het
Rbm45	T	A	2: 76,370,250	L41Q	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Scel	A	T	14: 103,586,493	I386F	probably benign	Het
Serpinb5	A	T	1: 106,881,757	N298Y	possibly damaging	Het
Sirt3	A	T	7: 140,869,493	L180Q	probably damaging	Het
Slc24a2	C	T	4: 86,991,388	V698I	probably damaging	Het
Slc43a3	A	T	2: 84,957,723	H483L	probably damaging	Het
Snrnp35	A	G	5: 124,490,199	D25G	probably benign	Het
Snrnp40	T	C	4: 130,362,646	S55P	probably damaging	Het
Snx9	T	A	17: 5,920,580	C399S	probably damaging	Het
Soga1	T	C	2: 157,040,734	E466G	probably damaging	Het
Ttbk2	T	C	2: 120,825,262		probably benign	Het
Vmn1r1	A	G	1: 182,157,776	V108A	possibly damaging	Het
Vmn1r201	T	A	13: 22,475,502	N295K	probably benign	Het
Zfp292	G	A	4: 34,807,491	P1851L	possibly damaging	Het
Zfp472	A	T	17: 32,977,743	D264V	probably damaging	Het

Other mutations in Herc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Herc2	APN	7	56124299	missense	probably damaging	1.00
IGL00529:Herc2	APN	7	56157753	missense	probably benign
IGL00548:Herc2	APN	7	56206565	missense	probably benign	0.20
IGL00970:Herc2	APN	7	56181064	splice site	probably benign
IGL01141:Herc2	APN	7	56212841	missense	possibly damaging	0.47
IGL01147:Herc2	APN	7	56156949	missense	probably benign	0.43
IGL01150:Herc2	APN	7	56181133	missense	probably damaging	1.00
IGL01519:Herc2	APN	7	56103950	missense	probably damaging	1.00
IGL01576:Herc2	APN	7	56226661	critical splice donor site	probably null
IGL01626:Herc2	APN	7	56085142	missense	probably benign	0.02
IGL01658:Herc2	APN	7	56159452	missense	probably damaging	1.00
IGL01707:Herc2	APN	7	56165187	missense	probably damaging	1.00
IGL01727:Herc2	APN	7	56137806	missense	probably damaging	1.00
IGL01935:Herc2	APN	7	56153793	missense	probably benign
IGL01969:Herc2	APN	7	56185831	splice site	probably benign
IGL02074:Herc2	APN	7	56087444	splice site	probably benign
IGL02261:Herc2	APN	7	56206744	missense	probably damaging	0.99
IGL02339:Herc2	APN	7	56121722	missense	probably benign	0.01
IGL02353:Herc2	APN	7	56114812	missense	probably damaging	1.00
IGL02360:Herc2	APN	7	56114812	missense	probably damaging	1.00
IGL02409:Herc2	APN	7	56220469	splice site	probably null
IGL02528:Herc2	APN	7	56108893	splice site	probably benign
IGL02571:Herc2	APN	7	56153386	missense	probably damaging	1.00
IGL02578:Herc2	APN	7	56106535	splice site	probably null
IGL02661:Herc2	APN	7	56113073	missense	probably damaging	1.00
IGL02664:Herc2	APN	7	56135678	nonsense	probably null
IGL02675:Herc2	APN	7	56164101	missense	probably damaging	0.99
IGL02689:Herc2	APN	7	56165283	splice site	probably benign
IGL02710:Herc2	APN	7	56137814	missense	possibly damaging	0.95
IGL02750:Herc2	APN	7	56204379	splice site	probably benign
IGL02754:Herc2	APN	7	56097498	missense	probably damaging	1.00
IGL03029:Herc2	APN	7	56168967	missense	probably damaging	1.00
IGL03039:Herc2	APN	7	56169021	splice site	probably benign
IGL03082:Herc2	APN	7	56185923	missense	probably benign	0.19
IGL03090:Herc2	APN	7	56204473	missense	probably damaging	0.96
IGL03154:Herc2	APN	7	56202159	missense	probably damaging	1.00
IGL03165:Herc2	APN	7	56191912	missense	probably damaging	1.00
IGL03201:Herc2	APN	7	56219768	missense	probably damaging	1.00
IGL03234:Herc2	APN	7	56103862	missense	probably damaging	1.00
IGL03293:Herc2	APN	7	56155130	missense	probably benign	0.43
IGL03331:Herc2	APN	7	56135267	splice site	probably benign
IGL03340:Herc2	APN	7	56090920	missense	possibly damaging	0.51
IGL03409:Herc2	APN	7	56228569	missense	probably damaging	1.00
alarmed	UTSW	7	56229662	missense	possibly damaging	0.92
hyper	UTSW	7	56159417	missense	probably damaging	1.00
R0798_herc2_487	UTSW	7	56135683	critical splice donor site	probably null
R1370_Herc2_948	UTSW	7	56168873	missense	probably benign	0.01
R2030_Herc2_144	UTSW	7	56184373	missense	probably damaging	0.99
uptight	UTSW	7	56113210	missense	probably damaging	1.00
I0000:Herc2	UTSW	7	56136729	splice site	probably benign
PIT1430001:Herc2	UTSW	7	56226954	missense	probably damaging	1.00
R0009:Herc2	UTSW	7	56207812	missense	probably benign	0.03
R0009:Herc2	UTSW	7	56207812	missense	probably benign	0.03
R0058:Herc2	UTSW	7	56170483	missense	possibly damaging	0.93
R0114:Herc2	UTSW	7	56153774	splice site	probably benign
R0117:Herc2	UTSW	7	56213611	splice site	probably benign
R0141:Herc2	UTSW	7	56121561	missense	probably benign	0.17
R0266:Herc2	UTSW	7	56206578	missense	probably damaging	1.00
R0401:Herc2	UTSW	7	56157732	missense	probably damaging	0.99
R0403:Herc2	UTSW	7	56159417	missense	probably damaging	1.00
R0437:Herc2	UTSW	7	56219815	nonsense	probably null
R0491:Herc2	UTSW	7	56122366	missense	possibly damaging	0.54
R0499:Herc2	UTSW	7	56184369	nonsense	probably null
R0580:Herc2	UTSW	7	56138791	missense	probably damaging	1.00
R0650:Herc2	UTSW	7	56113210	missense	probably damaging	1.00
R0744:Herc2	UTSW	7	56206036	splice site	probably benign
R0798:Herc2	UTSW	7	56135683	critical splice donor site	probably null
R0842:Herc2	UTSW	7	56121705	missense	probably benign
R0849:Herc2	UTSW	7	56206578	missense	probably damaging	1.00
R0850:Herc2	UTSW	7	56204483	missense	probably benign	0.09
R0926:Herc2	UTSW	7	56132548	missense	possibly damaging	0.67
R1146:Herc2	UTSW	7	56146696	missense	probably benign
R1146:Herc2	UTSW	7	56146696	missense	probably benign
R1292:Herc2	UTSW	7	56197203	missense	probably benign	0.05
R1370:Herc2	UTSW	7	56168873	missense	probably benign	0.01
R1443:Herc2	UTSW	7	56204733	missense	possibly damaging	0.69
R1445:Herc2	UTSW	7	56168996	missense	probably damaging	1.00
R1541:Herc2	UTSW	7	56135657	missense	probably damaging	1.00
R1550:Herc2	UTSW	7	56135658	missense	probably damaging	1.00
R1551:Herc2	UTSW	7	56146669	missense	probably benign	0.01
R1633:Herc2	UTSW	7	56229369	missense	probably null	1.00
R1635:Herc2	UTSW	7	56136667	missense	probably benign	0.00
R1659:Herc2	UTSW	7	56135105	missense	probably benign	0.00
R1682:Herc2	UTSW	7	56088400	missense	possibly damaging	0.87
R1697:Herc2	UTSW	7	56153905	missense	probably benign	0.43
R1748:Herc2	UTSW	7	56148823	critical splice donor site	probably null
R1802:Herc2	UTSW	7	56184332	missense	probably damaging	1.00
R1835:Herc2	UTSW	7	56206765	nonsense	probably null
R1836:Herc2	UTSW	7	56155105	nonsense	probably null
R1872:Herc2	UTSW	7	56157509	missense	probably benign	0.18
R1889:Herc2	UTSW	7	56189813	missense	possibly damaging	0.60
R1906:Herc2	UTSW	7	56114864	missense	probably benign	0.01
R2004:Herc2	UTSW	7	56137859	missense	probably damaging	1.00
R2030:Herc2	UTSW	7	56184373	missense	probably damaging	0.99
R2037:Herc2	UTSW	7	56205961	missense	probably damaging	1.00
R2059:Herc2	UTSW	7	56163897	missense	probably damaging	1.00
R2068:Herc2	UTSW	7	56132497	missense	probably damaging	1.00
R2072:Herc2	UTSW	7	56226964	missense	probably damaging	1.00
R2085:Herc2	UTSW	7	56212965	missense	possibly damaging	0.94
R2115:Herc2	UTSW	7	56185828	splice site	probably benign
R2160:Herc2	UTSW	7	56212922	missense	probably benign	0.00
R2173:Herc2	UTSW	7	56185951	missense	probably benign	0.27
R2221:Herc2	UTSW	7	56169018	critical splice donor site	probably null
R2280:Herc2	UTSW	7	56137271	missense	possibly damaging	0.79
R3078:Herc2	UTSW	7	56137243	missense	probably benign
R3104:Herc2	UTSW	7	56135355	missense	probably benign	0.23
R3177:Herc2	UTSW	7	56153428	missense	probably benign	0.00
R3277:Herc2	UTSW	7	56153428	missense	probably benign	0.00
R3766:Herc2	UTSW	7	56163824	missense	probably damaging	1.00
R3770:Herc2	UTSW	7	56165007	missense	probably benign
R3807:Herc2	UTSW	7	56207809	missense	probably damaging	1.00
R3912:Herc2	UTSW	7	56098437	missense	probably damaging	0.98
R4004:Herc2	UTSW	7	56106465	missense	possibly damaging	0.53
R4039:Herc2	UTSW	7	56156411	missense	probably damaging	0.98
R4190:Herc2	UTSW	7	56122448	missense	probably benign	0.03
R4225:Herc2	UTSW	7	56164987	missense	probably damaging	1.00
R4334:Herc2	UTSW	7	56226654	missense	probably damaging	1.00
R4405:Herc2	UTSW	7	56170477	missense	probably damaging	1.00
R4448:Herc2	UTSW	7	56227892	missense	probably damaging	1.00
R4450:Herc2	UTSW	7	56227892	missense	probably damaging	1.00
R4565:Herc2	UTSW	7	56153838	missense	possibly damaging	0.71
R4667:Herc2	UTSW	7	56131253	missense	probably damaging	1.00
R4747:Herc2	UTSW	7	56106393	missense	possibly damaging	0.80
R4762:Herc2	UTSW	7	56170640	missense	probably benign	0.19
R4829:Herc2	UTSW	7	56106492	missense	probably benign	0.39
R4832:Herc2	UTSW	7	56098417	nonsense	probably null
R4895:Herc2	UTSW	7	56222986	missense	probably damaging	1.00
R4904:Herc2	UTSW	7	56157486	missense	probably damaging	0.99
R4908:Herc2	UTSW	7	56177912	missense	probably benign	0.01
R4911:Herc2	UTSW	7	56227892	missense	probably damaging	1.00
R4921:Herc2	UTSW	7	56229690	missense	probably benign	0.04
R4939:Herc2	UTSW	7	56206736	missense	probably damaging	1.00
R5155:Herc2	UTSW	7	56227826	missense	possibly damaging	0.85
R5184:Herc2	UTSW	7	56122351	missense	probably damaging	1.00
R5269:Herc2	UTSW	7	56168870	nonsense	probably null
R5306:Herc2	UTSW	7	56184961	missense	probably damaging	1.00
R5314:Herc2	UTSW	7	56219786	missense	probably damaging	0.99
R5418:Herc2	UTSW	7	56137565	missense	probably damaging	1.00
R5420:Herc2	UTSW	7	56203830	missense	probably damaging	0.96
R5463:Herc2	UTSW	7	56194262	missense	probably damaging	1.00
R5510:Herc2	UTSW	7	56206771	missense	probably damaging	1.00
R5634:Herc2	UTSW	7	56206783	missense	probably damaging	1.00
R5638:Herc2	UTSW	7	56204416	missense	probably benign	0.01
R5690:Herc2	UTSW	7	56157705	missense	probably benign
R5762:Herc2	UTSW	7	56197190	missense	possibly damaging	0.68
R5807:Herc2	UTSW	7	56230919	missense	probably damaging	0.99
R5878:Herc2	UTSW	7	56124248	missense	probably benign
R6036:Herc2	UTSW	7	56068053	missense	probably benign	0.01
R6036:Herc2	UTSW	7	56068053	missense	probably benign	0.01
R6083:Herc2	UTSW	7	56228505	missense	probably benign	0.00
R6192:Herc2	UTSW	7	56207762	missense	probably damaging	1.00
R6193:Herc2	UTSW	7	56156901	missense	probably damaging	0.98
R6261:Herc2	UTSW	7	56197072	nonsense	probably null
R6267:Herc2	UTSW	7	56153166	nonsense	probably null
R6267:Herc2	UTSW	7	56204718	missense	possibly damaging	0.51
R6298:Herc2	UTSW	7	56191265	missense	probably benign
R6299:Herc2	UTSW	7	56135055	missense	possibly damaging	0.47
R6326:Herc2	UTSW	7	56222934	missense	probably damaging	0.98
R6347:Herc2	UTSW	7	56194403	critical splice donor site	probably null
R6394:Herc2	UTSW	7	56215981	missense	probably damaging	1.00
R6500:Herc2	UTSW	7	56146645	nonsense	probably null
R6526:Herc2	UTSW	7	56157330	missense	probably damaging	0.99
R6592:Herc2	UTSW	7	56207690	critical splice acceptor site	probably null
R6619:Herc2	UTSW	7	56068092	nonsense	probably null
R6719:Herc2	UTSW	7	56212826	missense	probably damaging	1.00
R6750:Herc2	UTSW	7	56097447	missense	probably damaging	1.00
R6807:Herc2	UTSW	7	56164922	missense	probably damaging	1.00
R6811:Herc2	UTSW	7	56113433	nonsense	probably null
R6837:Herc2	UTSW	7	56189841	missense	possibly damaging	0.89
R6838:Herc2	UTSW	7	56108778	missense	probably damaging	1.00
R6902:Herc2	UTSW	7	56135486	missense	probably benign	0.37
R6983:Herc2	UTSW	7	56106453	missense	possibly damaging	0.74
R6985:Herc2	UTSW	7	56106453	missense	possibly damaging	0.74
R6985:Herc2	UTSW	7	56132480	missense	probably damaging	1.00
R6986:Herc2	UTSW	7	56106453	missense	possibly damaging	0.74
R6987:Herc2	UTSW	7	56106453	missense	possibly damaging	0.74
R7113:Herc2	UTSW	7	56203849	missense	probably damaging	0.99
R7173:Herc2	UTSW	7	56203827	missense	probably damaging	1.00
R7202:Herc2	UTSW	7	56131286	missense	probably damaging	0.99
R7205:Herc2	UTSW	7	56182640	missense	probably damaging	1.00
R7236:Herc2	UTSW	7	56085080	missense	probably benign	0.29
R7297:Herc2	UTSW	7	56136658	missense	probably benign	0.00
R7358:Herc2	UTSW	7	56182675	missense	possibly damaging	0.48
R7438:Herc2	UTSW	7	56103718	splice site	probably null
R7537:Herc2	UTSW	7	56219779	nonsense	probably null
R7578:Herc2	UTSW	7	56134800	missense	probably benign	0.07
R7614:Herc2	UTSW	7	56153275	nonsense	probably null
R7638:Herc2	UTSW	7	56157438	missense	probably benign	0.26
R7638:Herc2	UTSW	7	56220525	missense	probably damaging	1.00
R7646:Herc2	UTSW	7	56134613	missense	probably benign
R7663:Herc2	UTSW	7	56136685	missense	probably benign
R7665:Herc2	UTSW	7	56153155	missense	probably damaging	1.00
R7691:Herc2	UTSW	7	56191845	missense	probably benign
R7733:Herc2	UTSW	7	56188664	missense	probably damaging	0.99
R7767:Herc2	UTSW	7	56228527	missense	probably benign	0.39
R7802:Herc2	UTSW	7	56164090	missense	probably damaging	1.00
R7847:Herc2	UTSW	7	56157560	critical splice donor site	probably null
R7956:Herc2	UTSW	7	56113400	missense	probably damaging	0.97
R7985:Herc2	UTSW	7	56165244	missense	probably benign
R8003:Herc2	UTSW	7	56168904	missense	possibly damaging	0.94
R8045:Herc2	UTSW	7	56184900	missense	probably damaging	1.00
R8085:Herc2	UTSW	7	56229679	missense	probably benign	0.01
R8134:Herc2	UTSW	7	56085136	missense	probably benign	0.10
R8259:Herc2	UTSW	7	56205890	missense	probably damaging	0.99
R8286:Herc2	UTSW	7	56229662	missense	possibly damaging	0.92
R8304:Herc2	UTSW	7	56159438	missense	probably damaging	1.00
R8321:Herc2	UTSW	7	56229348	missense	possibly damaging	0.84
R8332:Herc2	UTSW	7	56146595	missense	probably damaging	1.00
R8432:Herc2	UTSW	7	56155112	missense	probably benign	0.14
R8516:Herc2	UTSW	7	56206570	missense	probably benign	0.05
R8676:Herc2	UTSW	7	56188613	missense	probably damaging	1.00
R8738:Herc2	UTSW	7	56148654	missense	possibly damaging	0.78
R8742:Herc2	UTSW	7	56094395	missense	probably benign	0.12
R8796:Herc2	UTSW	7	56135375	missense	probably benign	0.01
R8825:Herc2	UTSW	7	56050878	start codon destroyed	probably null	0.01
R8826:Herc2	UTSW	7	56106396	missense	probably benign	0.12
R8842:Herc2	UTSW	7	56088311	missense	probably damaging	0.99
R9103:Herc2	UTSW	7	56135055	missense	possibly damaging	0.47
R9124:Herc2	UTSW	7	56184308	missense	probably damaging	1.00
R9134:Herc2	UTSW	7	56182429	missense	probably damaging	0.99
R9168:Herc2	UTSW	7	56152460	missense	probably damaging	0.99
R9173:Herc2	UTSW	7	56206602	missense	probably damaging	0.97
R9238:Herc2	UTSW	7	56163760	missense	probably damaging	0.98
R9249:Herc2	UTSW	7	56113142	missense	probably damaging	1.00
R9344:Herc2	UTSW	7	56122364	missense	probably benign	0.07
R9432:Herc2	UTSW	7	56131184	missense	probably damaging	1.00
R9472:Herc2	UTSW	7	56164095	missense	probably damaging	1.00
R9513:Herc2	UTSW	7	56113100	missense	probably damaging	1.00
R9579:Herc2	UTSW	7	56108752	missense	probably damaging	0.99
R9596:Herc2	UTSW	7	56184847	missense
R9664:Herc2	UTSW	7	56170590	missense	possibly damaging	0.90
R9760:Herc2	UTSW	7	56163911	critical splice donor site	probably null
R9781:Herc2	UTSW	7	56100348	missense	possibly damaging	0.53
RF024:Herc2	UTSW	7	56226525	missense	probably damaging	1.00
X0011:Herc2	UTSW	7	56131292	missense	probably benign
X0023:Herc2	UTSW	7	56090918	missense	possibly damaging	0.73
X0057:Herc2	UTSW	7	56229690	missense	probably benign	0.04
X0064:Herc2	UTSW	7	56191211	missense	probably benign	0.01
X0064:Herc2	UTSW	7	56191258	missense	probably benign
Z1088:Herc2	UTSW	7	56131292	missense	probably benign
Z1088:Herc2	UTSW	7	56215381	missense	possibly damaging	0.86
Z1088:Herc2	UTSW	7	56215432	missense	probably damaging	1.00
Z1088:Herc2	UTSW	7	56226589	missense	probably damaging	1.00
Z1088:Herc2	UTSW	7	56087341	missense	probably benign	0.00
Z1176:Herc2	UTSW	7	56097533	missense	possibly damaging	0.48
Z1176:Herc2	UTSW	7	56131292	missense	probably benign
Z1176:Herc2	UTSW	7	56132498	missense	probably damaging	1.00
Z1177:Herc2	UTSW	7	56121589	missense	possibly damaging	0.55
Z1177:Herc2	UTSW	7	56131292	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGTCTGCCCTGAATGTGG -3'
(R):5'- TCCATTCCTTAGGAACCTAGCATAG -3'

Sequencing Primer
(F):5'- AGCTTGTTTGCAGGTATGATAATTC -3'
(R):5'- CCTTAGGAACCTAGCATAGTACTTC -3'

Posted On

2016-09-06