Mutagenetix > Incidental Mutation

Incidental Mutation 'R5369:Eml5'

429564

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

042946-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R5369 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 98858783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 725 (G725D)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065716
AA Change: G686D

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: G686D

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: G725D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.3829

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	T	A	6: 41,033,006	R131S	probably benign	Het
A2ml1	T	C	6: 128,568,833	T444A	probably damaging	Het
A330070K13Rik	G	A	5: 130,379,091		probably benign	Het
Abcb8	C	T	5: 24,400,139	R108C	possibly damaging	Het
Acbd5	T	A	2: 23,112,510	L508Q	probably damaging	Het
Asb15	T	C	6: 24,562,564	V175A	probably benign	Het
B3galnt2	T	C	13: 13,994,425		probably null	Het
BC024139	A	C	15: 76,120,222	S711R	probably benign	Het
Bod1l	A	G	5: 41,827,183	I508T	probably damaging	Het
Btnl6	T	A	17: 34,507,985	R524*	probably null	Het
C3	C	A	17: 57,221,159	D687Y	probably benign	Het
Ccbe1	G	A	18: 66,061,414	A367V	probably benign	Het
Ccr1	A	T	9: 123,964,289	M68K	probably damaging	Het
Cd27	T	A	6: 125,234,364		probably benign	Het
Celf2	C	A	2: 7,081,081		probably benign	Het
Cfap54	T	C	10: 93,061,257		probably benign	Het
Cfap97	A	G	8: 46,169,650	K26E	probably damaging	Het
Clcn4	T	A	7: 7,296,033	I48F	probably benign	Het
Cnot7	A	T	8: 40,494,020	N238K	probably benign	Het
Colec12	A	G	18: 9,866,750	I654V	unknown	Het
Dip2a	A	G	10: 76,292,360	I22T	probably damaging	Het
Eif4g3	C	T	4: 138,183,334	T1375M	possibly damaging	Het
F12	T	C	13: 55,418,491	E496G	probably benign	Het
Fam227a	A	T	15: 79,615,436	S573T	probably benign	Het
Fnip1	T	C	11: 54,502,589	V593A	probably benign	Het
Focad	T	A	4: 88,121,373		probably benign	Het
Frem1	A	G	4: 83,001,739	I460T	possibly damaging	Het
Galnt10	T	G	11: 57,765,747		probably null	Het
Gm5592	A	T	7: 41,218,211		probably benign	Het
Gm6185	A	T	1: 161,209,760		noncoding transcript	Het
Gm7935	A	T	15: 74,081,114		noncoding transcript	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Gstm5	G	A	3: 107,898,466	A198T	probably damaging	Het
Herc2	T	A	7: 56,182,700	V3048D	probably damaging	Het
Htra4	T	G	8: 25,033,569	I327L	possibly damaging	Het
Ifi209	T	C	1: 173,637,307	M1T	probably null	Het
Ints6	T	C	14: 62,743,935	T135A	probably damaging	Het
Itpr1	T	A	6: 108,519,424	I2604N	probably damaging	Het
Krt6a	T	A	15: 101,692,558	M268L	probably benign	Het
Lrp1b	G	T	2: 41,004,613	S2201*	probably null	Het
Lrp2	T	C	2: 69,459,560	N3645S	probably benign	Het
Lrrc15	A	T	16: 30,272,904	I539N	possibly damaging	Het
Map3k6	T	C	4: 133,247,681	I675T	probably damaging	Het
Map3k9	T	A	12: 81,722,052	E1074V	probably damaging	Het
Med13l	T	A	5: 118,724,010	S339R	probably benign	Het
Mrps18a	T	C	17: 46,125,626		probably benign	Het
Nat8f2	G	T	6: 85,867,872	Y169*	probably null	Het
Nlrp1b	A	G	11: 71,181,799	I406T	probably benign	Het
Npc1l1	A	G	11: 6,217,705		probably null	Het
Olfr202	A	T	16: 59,284,380	M39K	probably damaging	Het
Olfr419	A	G	1: 174,250,441	V162A	probably damaging	Het
Ostf1	C	T	19: 18,581,325	G198E	probably benign	Het
Pcsk5	A	G	19: 17,581,255	V596A	probably damaging	Het
Pde4c	T	C	8: 70,750,105	*647Q	probably null	Het
Pkm	A	T	9: 59,670,634	I245F	probably damaging	Het
Ptprj	T	C	2: 90,469,641	H179R	probably benign	Het
Rapgef2	A	T	3: 79,069,432	S1356T	probably benign	Het
Rbm45	T	A	2: 76,370,250	L41Q	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Scel	A	T	14: 103,586,493	I386F	probably benign	Het
Serpinb5	A	T	1: 106,881,757	N298Y	possibly damaging	Het
Sirt3	A	T	7: 140,869,493	L180Q	probably damaging	Het
Slc24a2	C	T	4: 86,991,388	V698I	probably damaging	Het
Slc43a3	A	T	2: 84,957,723	H483L	probably damaging	Het
Snrnp35	A	G	5: 124,490,199	D25G	probably benign	Het
Snrnp40	T	C	4: 130,362,646	S55P	probably damaging	Het
Snx9	T	A	17: 5,920,580	C399S	probably damaging	Het
Soga1	T	C	2: 157,040,734	E466G	probably damaging	Het
Ttbk2	T	C	2: 120,825,262		probably benign	Het
Vmn1r1	A	G	1: 182,157,776	V108A	possibly damaging	Het
Vmn1r201	T	A	13: 22,475,502	N295K	probably benign	Het
Zfp292	G	A	4: 34,807,491	P1851L	possibly damaging	Het
Zfp472	A	T	17: 32,977,743	D264V	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCGTGTCTTCACAGAGC -3'
(R):5'- CTCTGTGCATTAGATGTTGATCAGATG -3'

Sequencing Primer
(F):5'- TAGCCTCCATGGATACTGAATGC -3'
(R):5'- GAAAGATTAAAATGTGTTGTGCATGG -3'

Posted On

2016-09-06