Incidental Mutation 'R5369:Scel'
ID429570
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Namesciellin
Synonyms9230114I02Rik
MMRRC Submission 042946-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5369 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103513342-103612797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103586493 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 386 (I386F)
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: I406F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: I406F

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: I386F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0659 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,033,006 R131S probably benign Het
A2ml1 T C 6: 128,568,833 T444A probably damaging Het
A330070K13Rik G A 5: 130,379,091 probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acbd5 T A 2: 23,112,510 L508Q probably damaging Het
Asb15 T C 6: 24,562,564 V175A probably benign Het
B3galnt2 T C 13: 13,994,425 probably null Het
BC024139 A C 15: 76,120,222 S711R probably benign Het
Bod1l A G 5: 41,827,183 I508T probably damaging Het
Btnl6 T A 17: 34,507,985 R524* probably null Het
C3 C A 17: 57,221,159 D687Y probably benign Het
Ccbe1 G A 18: 66,061,414 A367V probably benign Het
Ccr1 A T 9: 123,964,289 M68K probably damaging Het
Cd27 T A 6: 125,234,364 probably benign Het
Celf2 C A 2: 7,081,081 probably benign Het
Cfap54 T C 10: 93,061,257 probably benign Het
Cfap97 A G 8: 46,169,650 K26E probably damaging Het
Clcn4 T A 7: 7,296,033 I48F probably benign Het
Cnot7 A T 8: 40,494,020 N238K probably benign Het
Colec12 A G 18: 9,866,750 I654V unknown Het
Dip2a A G 10: 76,292,360 I22T probably damaging Het
Eif4g3 C T 4: 138,183,334 T1375M possibly damaging Het
Eml5 C T 12: 98,858,783 G725D probably damaging Het
F12 T C 13: 55,418,491 E496G probably benign Het
Fam227a A T 15: 79,615,436 S573T probably benign Het
Fnip1 T C 11: 54,502,589 V593A probably benign Het
Focad T A 4: 88,121,373 probably benign Het
Frem1 A G 4: 83,001,739 I460T possibly damaging Het
Galnt10 T G 11: 57,765,747 probably null Het
Gm5592 A T 7: 41,218,211 probably benign Het
Gm6185 A T 1: 161,209,760 noncoding transcript Het
Gm7935 A T 15: 74,081,114 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Gstm5 G A 3: 107,898,466 A198T probably damaging Het
Herc2 T A 7: 56,182,700 V3048D probably damaging Het
Htra4 T G 8: 25,033,569 I327L possibly damaging Het
Ifi209 T C 1: 173,637,307 M1T probably null Het
Ints6 T C 14: 62,743,935 T135A probably damaging Het
Itpr1 T A 6: 108,519,424 I2604N probably damaging Het
Krt6a T A 15: 101,692,558 M268L probably benign Het
Lrp1b G T 2: 41,004,613 S2201* probably null Het
Lrp2 T C 2: 69,459,560 N3645S probably benign Het
Lrrc15 A T 16: 30,272,904 I539N possibly damaging Het
Map3k6 T C 4: 133,247,681 I675T probably damaging Het
Map3k9 T A 12: 81,722,052 E1074V probably damaging Het
Med13l T A 5: 118,724,010 S339R probably benign Het
Mrps18a T C 17: 46,125,626 probably benign Het
Nat8f2 G T 6: 85,867,872 Y169* probably null Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Npc1l1 A G 11: 6,217,705 probably null Het
Olfr202 A T 16: 59,284,380 M39K probably damaging Het
Olfr419 A G 1: 174,250,441 V162A probably damaging Het
Ostf1 C T 19: 18,581,325 G198E probably benign Het
Pcsk5 A G 19: 17,581,255 V596A probably damaging Het
Pde4c T C 8: 70,750,105 *647Q probably null Het
Pkm A T 9: 59,670,634 I245F probably damaging Het
Ptprj T C 2: 90,469,641 H179R probably benign Het
Rapgef2 A T 3: 79,069,432 S1356T probably benign Het
Rbm45 T A 2: 76,370,250 L41Q probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Serpinb5 A T 1: 106,881,757 N298Y possibly damaging Het
Sirt3 A T 7: 140,869,493 L180Q probably damaging Het
Slc24a2 C T 4: 86,991,388 V698I probably damaging Het
Slc43a3 A T 2: 84,957,723 H483L probably damaging Het
Snrnp35 A G 5: 124,490,199 D25G probably benign Het
Snrnp40 T C 4: 130,362,646 S55P probably damaging Het
Snx9 T A 17: 5,920,580 C399S probably damaging Het
Soga1 T C 2: 157,040,734 E466G probably damaging Het
Ttbk2 T C 2: 120,825,262 probably benign Het
Vmn1r1 A G 1: 182,157,776 V108A possibly damaging Het
Vmn1r201 T A 13: 22,475,502 N295K probably benign Het
Zfp292 G A 4: 34,807,491 P1851L possibly damaging Het
Zfp472 A T 17: 32,977,743 D264V probably damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GCTCCTCCTTATAACAGATGGTC -3'
(R):5'- ACATGTTTGTTTCCTGGTACATAC -3'

Sequencing Primer
(F):5'- TCTCACTCACACATTGTCACATATAC -3'
(R):5'- CTGGTACATACAAAAATAATGATGG -3'
Posted On2016-09-06