Incidental Mutation 'R5370:Padi3'
ID429596
Institutional Source Beutler Lab
Gene Symbol Padi3
Ensembl Gene ENSMUSG00000025328
Gene Namepeptidyl arginine deiminase, type III
SynonymsPAD type III, Pdi3, Pad3
MMRRC Submission 042947-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5370 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location140785365-140810648 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 140810538 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 24 (E24*)
Ref Sequence ENSEMBL: ENSMUSP00000026377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000026378]
Predicted Effect probably null
Transcript: ENSMUST00000026377
AA Change: E24*
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328
AA Change: E24*

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026378
SMART Domains Protein: ENSMUSP00000026378
Gene: ENSMUSG00000025329

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 5.4e-39 PFAM
Pfam:PAD_M 115 272 1.3e-63 PFAM
Pfam:PAD 280 659 9.4e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151848
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in coat/ hair and vibrissa morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Armc3 A C 2: 19,286,062 T451P probably benign Het
Ass1 G A 2: 31,518,733 V379M possibly damaging Het
Cdhr2 A G 13: 54,720,887 Y554C probably damaging Het
Clec4g C A 8: 3,718,344 R129L probably benign Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dnah9 T A 11: 66,029,354 T2238S probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Ephb2 T C 4: 136,771,570 E66G probably benign Het
Fam169a T A 13: 97,106,962 C167S probably damaging Het
Ggcx T C 6: 72,425,931 S291P possibly damaging Het
Gsdme T A 6: 50,229,306 I186F probably damaging Het
Gzma T A 13: 113,095,795 M191L probably damaging Het
Heatr1 T A 13: 12,401,522 S226T probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs6st1 T A 1: 36,069,081 S142T probably damaging Het
Ighv3-5 A G 12: 114,262,898 V36A probably benign Het
Leng8 A G 7: 4,145,434 D735G possibly damaging Het
Mapk13 T A 17: 28,776,352 Y182* probably null Het
Mrgprb8 A T 7: 48,388,820 T80S probably benign Het
Myom2 G A 8: 15,099,343 A605T probably benign Het
Nxf1 A G 19: 8,772,140 T134A probably damaging Het
Olfr136 G T 17: 38,335,444 G96* probably null Het
Pcdhga3 T A 18: 37,675,290 D265E probably damaging Het
Pros1 A T 16: 62,913,976 I382L probably benign Het
Ptpn23 A G 9: 110,385,701 V1544A possibly damaging Het
Rhoh G T 5: 65,892,578 A64S probably benign Het
Rnf115 A G 3: 96,758,020 T69A probably benign Het
Taf5 A G 19: 47,075,764 E382G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r104 A T 17: 20,030,188 I607N probably damaging Het
Vmn2r11 T C 5: 109,047,555 Y635C probably damaging Het
Vwa5a A G 9: 38,741,216 D765G probably benign Het
Wnk2 T C 13: 49,102,961 D228G probably damaging Het
Xirp2 A G 2: 67,512,152 D1579G possibly damaging Het
Other mutations in Padi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Padi3 APN 4 140803624 missense possibly damaging 0.78
IGL00948:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL00949:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL01021:Padi3 APN 4 140796334 splice site probably benign
IGL02400:Padi3 APN 4 140788868 missense probably benign 0.00
IGL02449:Padi3 APN 4 140789712 critical splice donor site probably null
IGL02600:Padi3 APN 4 140798156 missense probably benign 0.15
IGL03342:Padi3 APN 4 140810598 nonsense probably null
FR4304:Padi3 UTSW 4 140792972 critical splice donor site probably benign
PIT4544001:Padi3 UTSW 4 140791483 missense probably benign 0.00
R0455:Padi3 UTSW 4 140795713 missense probably damaging 1.00
R0743:Padi3 UTSW 4 140786429 missense probably benign 0.00
R1279:Padi3 UTSW 4 140803577 missense probably benign 0.00
R2081:Padi3 UTSW 4 140798979 missense probably damaging 1.00
R3016:Padi3 UTSW 4 140786587 missense probably damaging 1.00
R3853:Padi3 UTSW 4 140791269 splice site probably benign
R4599:Padi3 UTSW 4 140798111 missense probably damaging 1.00
R4909:Padi3 UTSW 4 140795626 missense probably damaging 1.00
R5482:Padi3 UTSW 4 140795843 missense probably damaging 0.99
R6084:Padi3 UTSW 4 140795843 missense probably damaging 1.00
R6151:Padi3 UTSW 4 140796394 missense probably damaging 1.00
R6277:Padi3 UTSW 4 140791161 critical splice donor site probably null
R6343:Padi3 UTSW 4 140803508 missense possibly damaging 0.58
R6749:Padi3 UTSW 4 140795853 missense possibly damaging 0.94
R7096:Padi3 UTSW 4 140800124 missense probably damaging 1.00
R7403:Padi3 UTSW 4 140800119 missense probably benign
R7798:Padi3 UTSW 4 140786439 missense probably benign
R7818:Padi3 UTSW 4 140798142 missense possibly damaging 0.72
R8375:Padi3 UTSW 4 140798096 missense probably damaging 1.00
RF025:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF032:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF040:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF043:Padi3 UTSW 4 140792972 critical splice donor site probably benign
Z1176:Padi3 UTSW 4 140795671 missense possibly damaging 0.92
Z1176:Padi3 UTSW 4 140798123 missense not run
Z1177:Padi3 UTSW 4 140798123 missense not run
Predicted Primers PCR Primer
(F):5'- TCCAATGTACGGAGCTCAGC -3'
(R):5'- AATAAGCTTGCGCCCTGAGC -3'

Sequencing Primer
(F):5'- CTGGATCCTCAGGTTCAAAAAC -3'
(R):5'- TTGCGCCCTGAGCTGGAG -3'
Posted On2016-09-06