Mutagenetix > Incidental Mutation

Incidental Mutation 'R5370:Ggcx'

429601

Institutional Source

Beutler Lab

Gene Symbol

Ggcx

Ensembl Gene

ENSMUSG00000053460

Gene Name

gamma-glutamyl carboxylase

Synonyms

vitamin K-dependent carboxylase

MMRRC Submission

042947-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.836) question?

Stock #

R5370 (G1)

Quality Score

122

Status

Not validated

Chromosome

Chromosomal Location

72414308-72430712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72425931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 291 (S291P)

Ref Sequence

ENSEMBL: ENSMUSP00000070109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065906] [ENSMUST00000205738]

AlphaFold

Q9QYC7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065906
AA Change: S291P

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: S291P

Domain	Start	End	E-Value	Type
HTTM	56	315	1.34e-131	SMART
low complexity region	368	377	N/A	INTRINSIC
low complexity region	630	645	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132995

Predicted Effect

probably benign
Transcript: ENSMUST00000205738

Predicted Effect

probably benign
Transcript: ENSMUST00000207000

Predicted Effect

probably benign
Transcript: ENSMUST00000207012

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	C	T	5: 24,400,139	R108C	possibly damaging	Het
Armc3	A	C	2: 19,286,062	T451P	probably benign	Het
Ass1	G	A	2: 31,518,733	V379M	possibly damaging	Het
Cdhr2	A	G	13: 54,720,887	Y554C	probably damaging	Het
Clec4g	C	A	8: 3,718,344	R129L	probably benign	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Dnah9	T	A	11: 66,029,354	T2238S	probably damaging	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Ephb2	T	C	4: 136,771,570	E66G	probably benign	Het
Fam169a	T	A	13: 97,106,962	C167S	probably damaging	Het
Gsdme	T	A	6: 50,229,306	I186F	probably damaging	Het
Gzma	T	A	13: 113,095,795	M191L	probably damaging	Het
Heatr1	T	A	13: 12,401,522	S226T	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hs6st1	T	A	1: 36,069,081	S142T	probably damaging	Het
Ighv3-5	A	G	12: 114,262,898	V36A	probably benign	Het
Leng8	A	G	7: 4,145,434	D735G	possibly damaging	Het
Mapk13	T	A	17: 28,776,352	Y182*	probably null	Het
Mrgprb8	A	T	7: 48,388,820	T80S	probably benign	Het
Myom2	G	A	8: 15,099,343	A605T	probably benign	Het
Nxf1	A	G	19: 8,772,140	T134A	probably damaging	Het
Olfr136	G	T	17: 38,335,444	G96*	probably null	Het
Padi3	C	A	4: 140,810,538	E24*	probably null	Het
Pcdhga3	T	A	18: 37,675,290	D265E	probably damaging	Het
Pros1	A	T	16: 62,913,976	I382L	probably benign	Het
Ptpn23	A	G	9: 110,385,701	V1544A	possibly damaging	Het
Rhoh	G	T	5: 65,892,578	A64S	probably benign	Het
Rnf115	A	G	3: 96,758,020	T69A	probably benign	Het
Taf5	A	G	19: 47,075,764	E382G	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn2r104	A	T	17: 20,030,188	I607N	probably damaging	Het
Vmn2r11	T	C	5: 109,047,555	Y635C	probably damaging	Het
Vwa5a	A	G	9: 38,741,216	D765G	probably benign	Het
Wnk2	T	C	13: 49,102,961	D228G	probably damaging	Het
Xirp2	A	G	2: 67,512,152	D1579G	possibly damaging	Het

Other mutations in Ggcx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01657:Ggcx	APN	6	72429958	splice site	probably null
IGL02373:Ggcx	APN	6	72427919	missense	probably damaging	1.00
IGL02589:Ggcx	APN	6	72429148	missense	probably damaging	1.00
IGL02634:Ggcx	APN	6	72418303	missense	probably damaging	1.00
IGL02661:Ggcx	APN	6	72418360	missense	possibly damaging	0.78
IGL02701:Ggcx	APN	6	72418472	intron	probably benign
R0503:Ggcx	UTSW	6	72429157	frame shift	probably null
R1034:Ggcx	UTSW	6	72414831	missense	probably damaging	1.00
R2219:Ggcx	UTSW	6	72427982	missense	probably benign	0.29
R3892:Ggcx	UTSW	6	72418372	missense	probably damaging	0.99
R3951:Ggcx	UTSW	6	72426558	missense	probably benign	0.01
R3952:Ggcx	UTSW	6	72426558	missense	probably benign	0.01
R4320:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4321:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4322:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4324:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4782:Ggcx	UTSW	6	72428892	missense	probably benign	0.01
R5523:Ggcx	UTSW	6	72424034	missense	probably damaging	1.00
R5902:Ggcx	UTSW	6	72429996	missense	possibly damaging	0.92
R6126:Ggcx	UTSW	6	72417983	missense	possibly damaging	0.57
R6199:Ggcx	UTSW	6	72430139	missense	possibly damaging	0.57
R6223:Ggcx	UTSW	6	72429605	missense	probably damaging	0.97
R6515:Ggcx	UTSW	6	72425832	missense	probably benign	0.33
R7205:Ggcx	UTSW	6	72428004	missense	probably damaging	1.00
R7923:Ggcx	UTSW	6	72427917	missense	probably damaging	1.00
R8034:Ggcx	UTSW	6	72428604	missense	possibly damaging	0.47
R8096:Ggcx	UTSW	6	72429993	missense	probably benign	0.33
R8116:Ggcx	UTSW	6	72429528	missense	possibly damaging	0.66
R8356:Ggcx	UTSW	6	72429591	missense	probably benign	0.03
R8977:Ggcx	UTSW	6	72429282	critical splice donor site	probably null
R9074:Ggcx	UTSW	6	72425941	missense	probably damaging	1.00
R9145:Ggcx	UTSW	6	72425922	missense	probably benign	0.18
R9285:Ggcx	UTSW	6	72418419	nonsense	probably null
R9362:Ggcx	UTSW	6	72428032	missense	probably damaging	1.00
R9497:Ggcx	UTSW	6	72429207	missense	probably damaging	1.00
Z1177:Ggcx	UTSW	6	72426519	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- ACCTGATGCTTGTGCTCTGG -3'
(R):5'- AGAAGTGCTTCACTGTTCTTCC -3'

Sequencing Primer
(F):5'- TGGGTGAGCCAGCTGAC -3'
(R):5'- AGACCCTCACTGTGCAGC -3'

Posted On

2016-09-06