Incidental Mutation 'R5370:Mapk13'
ID429618
Institutional Source Beutler Lab
Gene Symbol Mapk13
Ensembl Gene ENSMUSG00000004864
Gene Namemitogen-activated protein kinase 13
Synonymsp38 delta MAP kinase, SAPK4, Serk4
MMRRC Submission 042947-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R5370 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28769307-28778698 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 28776352 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 182 (Y182*)
Ref Sequence ENSEMBL: ENSMUSP00000115659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004986] [ENSMUST00000129096]
Predicted Effect probably null
Transcript: ENSMUST00000004986
AA Change: Y182*
SMART Domains Protein: ENSMUSP00000004986
Gene: ENSMUSG00000004864
AA Change: Y182*

DomainStartEndE-ValueType
S_TKc 25 308 8.72e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124099
Predicted Effect probably null
Transcript: ENSMUST00000129096
AA Change: Y182*
SMART Domains Protein: ENSMUSP00000115659
Gene: ENSMUSG00000004864
AA Change: Y182*

DomainStartEndE-ValueType
Pfam:Pkinase 25 209 1.1e-49 PFAM
Pfam:Pkinase_Tyr 27 210 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133786
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit improved glucose tolerance, increased insulin secretion, decreased blood glucose, and decreased susceptibility to diet- or chemically-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Armc3 A C 2: 19,286,062 T451P probably benign Het
Ass1 G A 2: 31,518,733 V379M possibly damaging Het
Cdhr2 A G 13: 54,720,887 Y554C probably damaging Het
Clec4g C A 8: 3,718,344 R129L probably benign Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dnah9 T A 11: 66,029,354 T2238S probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Ephb2 T C 4: 136,771,570 E66G probably benign Het
Fam169a T A 13: 97,106,962 C167S probably damaging Het
Ggcx T C 6: 72,425,931 S291P possibly damaging Het
Gsdme T A 6: 50,229,306 I186F probably damaging Het
Gzma T A 13: 113,095,795 M191L probably damaging Het
Heatr1 T A 13: 12,401,522 S226T probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs6st1 T A 1: 36,069,081 S142T probably damaging Het
Ighv3-5 A G 12: 114,262,898 V36A probably benign Het
Leng8 A G 7: 4,145,434 D735G possibly damaging Het
Mrgprb8 A T 7: 48,388,820 T80S probably benign Het
Myom2 G A 8: 15,099,343 A605T probably benign Het
Nxf1 A G 19: 8,772,140 T134A probably damaging Het
Olfr136 G T 17: 38,335,444 G96* probably null Het
Padi3 C A 4: 140,810,538 E24* probably null Het
Pcdhga3 T A 18: 37,675,290 D265E probably damaging Het
Pros1 A T 16: 62,913,976 I382L probably benign Het
Ptpn23 A G 9: 110,385,701 V1544A possibly damaging Het
Rhoh G T 5: 65,892,578 A64S probably benign Het
Rnf115 A G 3: 96,758,020 T69A probably benign Het
Taf5 A G 19: 47,075,764 E382G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r104 A T 17: 20,030,188 I607N probably damaging Het
Vmn2r11 T C 5: 109,047,555 Y635C probably damaging Het
Vwa5a A G 9: 38,741,216 D765G probably benign Het
Wnk2 T C 13: 49,102,961 D228G probably damaging Het
Xirp2 A G 2: 67,512,152 D1579G possibly damaging Het
Other mutations in Mapk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Mapk13 APN 17 28776405 missense probably damaging 1.00
IGL01918:Mapk13 APN 17 28775330 missense probably damaging 1.00
IGL02265:Mapk13 APN 17 28777718 splice site probably benign
IGL02451:Mapk13 APN 17 28776413 missense probably damaging 1.00
IGL02977:Mapk13 APN 17 28776348 missense probably damaging 1.00
IGL03118:Mapk13 APN 17 28777735 missense probably benign 0.14
IGL03188:Mapk13 APN 17 28776583 intron probably benign
R0501:Mapk13 UTSW 17 28776353 missense probably damaging 1.00
R0538:Mapk13 UTSW 17 28775255 missense probably damaging 1.00
R2240:Mapk13 UTSW 17 28778111 missense probably damaging 0.98
R4368:Mapk13 UTSW 17 28777565 splice site probably null
R4613:Mapk13 UTSW 17 28769452 missense probably damaging 1.00
R4649:Mapk13 UTSW 17 28778487 nonsense probably null
R4684:Mapk13 UTSW 17 28770049 missense probably damaging 1.00
R4796:Mapk13 UTSW 17 28775554 missense probably damaging 1.00
R4863:Mapk13 UTSW 17 28776310 missense probably damaging 1.00
R4923:Mapk13 UTSW 17 28778223 missense probably benign
R5220:Mapk13 UTSW 17 28778491 missense probably benign 0.00
R5247:Mapk13 UTSW 17 28777751 missense probably benign 0.01
R6838:Mapk13 UTSW 17 28777561 splice site probably null
R6843:Mapk13 UTSW 17 28775453 intron probably null
R7187:Mapk13 UTSW 17 28776387 missense probably damaging 1.00
Z1088:Mapk13 UTSW 17 28777533 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CCTGGCTGTGAATGAAGACTG -3'
(R):5'- GAAGAGTGTCTTTCCAGTCAGC -3'

Sequencing Primer
(F):5'- CTGTGAATGAAGACTGTGAGCTG -3'
(R):5'- GCATTTCTGCCATGATGCAAC -3'
Posted On2016-09-06