Incidental Mutation 'R5396:Myo3b'
ID 429627
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 044394-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5396 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69957329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 185 (I185L)
Ref Sequence ENSEMBL: ENSMUSP00000107860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112241] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect possibly damaging
Transcript: ENSMUST00000060208
AA Change: I264L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: I264L

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112241
AA Change: I185L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107860
Gene: ENSMUSG00000042064
AA Change: I185L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 187 3.7e-30 PFAM
Pfam:Pkinase 1 188 8.3e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112243
AA Change: I236L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: I236L

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T C 2: 127,028,873 (GRCm39) T109A probably damaging Het
A430005L14Rik GCC G 4: 154,045,410 (GRCm39) probably null Het
Actr1a T C 19: 46,384,103 (GRCm39) D5G possibly damaging Het
Adra2c A G 5: 35,438,217 (GRCm39) T330A probably benign Het
Ahcyl2 C T 6: 29,859,697 (GRCm39) probably benign Het
Ahnak T C 19: 8,984,539 (GRCm39) V1941A probably damaging Het
Akr1b7 G A 6: 34,389,411 (GRCm39) probably null Het
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Ank2 A G 3: 126,746,875 (GRCm39) V570A probably damaging Het
Ano4 T C 10: 88,948,702 (GRCm39) E302G probably damaging Het
Bop1 A T 15: 76,339,489 (GRCm39) H285Q probably damaging Het
Btbd19 G A 4: 116,980,957 (GRCm39) A104V probably damaging Het
Catsperb A T 12: 101,560,543 (GRCm39) I845L possibly damaging Het
Ccdc28b G T 4: 129,513,238 (GRCm39) Q184K probably damaging Het
Cd101 A G 3: 100,926,126 (GRCm39) S198P probably damaging Het
Cdc7 A T 5: 107,117,163 (GRCm39) probably null Het
Cdhr2 A G 13: 54,884,269 (GRCm39) D1268G probably benign Het
Celsr3 C T 9: 108,705,781 (GRCm39) R755W probably damaging Het
Chrnb1 T A 11: 69,684,979 (GRCm39) N117I probably damaging Het
Chst11 C A 10: 83,027,083 (GRCm39) P170Q probably damaging Het
Clca3b A G 3: 144,552,932 (GRCm39) Y98H probably damaging Het
Crnkl1 A G 2: 145,770,132 (GRCm39) V237A possibly damaging Het
Ctnnbl1 G A 2: 157,659,752 (GRCm39) probably null Het
Dbndd1 C A 8: 124,236,582 (GRCm39) R95S probably damaging Het
Ddx3y A G Y: 1,265,965 (GRCm39) V344A probably damaging Het
Defb30 A T 14: 63,273,559 (GRCm39) probably null Het
Dennd10 T C 19: 60,823,274 (GRCm39) L303P probably benign Het
Dnah17 C T 11: 118,018,108 (GRCm39) R129Q probably benign Het
Dnhd1 A T 7: 105,362,891 (GRCm39) M3818L probably benign Het
Dusp4 G T 8: 35,284,458 (GRCm39) D258Y probably damaging Het
E2f1 A T 2: 154,406,368 (GRCm39) F103I probably benign Het
Elavl2 T C 4: 91,149,055 (GRCm39) Y248C probably damaging Het
Ephb3 T C 16: 21,037,855 (GRCm39) V310A possibly damaging Het
Erbin A G 13: 103,993,917 (GRCm39) probably null Het
Etv4 A T 11: 101,666,167 (GRCm39) H120Q probably damaging Het
Fcgbpl1 T C 7: 27,839,608 (GRCm39) F474L probably benign Het
Flot2 T A 11: 77,940,314 (GRCm39) C20* probably null Het
Fsip2 G A 2: 82,821,262 (GRCm39) G5665D probably benign Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Glrp1 TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG 1: 88,431,066 (GRCm39) probably benign Het
Gm43302 A T 5: 105,427,955 (GRCm39) L202* probably null Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hnf1b A T 11: 83,746,863 (GRCm39) M160L probably damaging Het
Inhbe T C 10: 127,186,470 (GRCm39) T237A possibly damaging Het
Kdm5b G A 1: 134,549,836 (GRCm39) probably null Het
Kmt2c A T 5: 25,499,732 (GRCm39) probably null Het
Kyat3 A G 3: 142,440,367 (GRCm39) K364E probably benign Het
Lars1 T A 18: 42,350,024 (GRCm39) T927S probably benign Het
Mfap1b A T 2: 121,304,371 (GRCm39) M8K probably benign Het
Mroh8 G A 2: 157,070,576 (GRCm39) P592S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or1x6 C T 11: 50,939,297 (GRCm39) A121V probably damaging Het
Or4c110 A T 2: 88,832,540 (GRCm39) L31M probably benign Het
Or51a24 T C 7: 103,734,098 (GRCm39) Y63C probably benign Het
Pcdha8 T A 18: 37,126,787 (GRCm39) V423E probably damaging Het
Pcdhb21 G T 18: 37,648,772 (GRCm39) V634L probably benign Het
Pde8a T C 7: 80,983,170 (GRCm39) V791A probably damaging Het
Pds5a A G 5: 65,795,920 (GRCm39) S657P probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,927,719 (GRCm39) probably benign Het
Rad51d A G 11: 82,781,196 (GRCm39) V17A possibly damaging Het
Sdc1 A T 12: 8,841,743 (GRCm39) probably null Het
Sdcbp2 T A 2: 151,429,057 (GRCm39) I152N probably damaging Het
Slc4a4 G T 5: 89,194,076 (GRCm39) M141I probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Spata6 T C 4: 111,656,315 (GRCm39) C320R probably damaging Het
Spata6l T C 19: 28,905,089 (GRCm39) H325R possibly damaging Het
Ssu2 T A 6: 112,357,957 (GRCm39) T129S probably damaging Het
Stat5a T A 11: 100,771,409 (GRCm39) W631R probably damaging Het
Sult1c2 T A 17: 54,143,939 (GRCm39) N122I possibly damaging Het
Synpo2 G A 3: 122,911,331 (GRCm39) Q105* probably null Het
Tert G A 13: 73,787,362 (GRCm39) V783I probably damaging Het
Ticam1 G T 17: 56,578,117 (GRCm39) T326K probably benign Het
Tmem63b T C 17: 45,980,888 (GRCm39) M269V possibly damaging Het
Tmem86a T A 7: 46,702,794 (GRCm39) V73E possibly damaging Het
Trpv4 G A 5: 114,761,675 (GRCm39) R818C possibly damaging Het
Tstd2 A G 4: 46,135,542 (GRCm39) S4P probably benign Het
Ttn A T 2: 76,644,715 (GRCm39) V4686E probably damaging Het
Ubash3b A G 9: 40,954,769 (GRCm39) probably null Het
Usp31 A G 7: 121,267,005 (GRCm39) probably null Het
Usp33 A G 3: 152,089,824 (GRCm39) E780G possibly damaging Het
Vapb T A 2: 173,613,336 (GRCm39) Y78* probably null Het
Vps13b G A 15: 35,887,094 (GRCm39) R3227Q probably damaging Het
Vps33a A T 5: 123,696,693 (GRCm39) I320N probably damaging Het
Wnt5a T C 14: 28,244,727 (GRCm39) C305R probably damaging Het
Zbtb38 A G 9: 96,569,696 (GRCm39) C463R probably damaging Het
Zc3h12d G A 10: 7,742,090 (GRCm39) C263Y probably damaging Het
Zfp971 G A 2: 177,675,526 (GRCm39) R375Q probably damaging Het
Znrf1 T A 8: 112,345,826 (GRCm39) probably null Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGGTTTCCAGGCATCTG -3'
(R):5'- CTCGCCATTTCTCAGGGAAC -3'

Sequencing Primer
(F):5'- CAGGCATCTGGGGTGACAGTG -3'
(R):5'- TCTCAGGGAACTTATCTTGTAGC -3'
Posted On 2016-09-06