Incidental Mutation 'R5396:Celsr3'
ID429679
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
MMRRC Submission 044394-MU
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5396 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108828582 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 755 (R755W)
Ref Sequence ENSEMBL: ENSMUSP00000150759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]
Predicted Effect probably damaging
Transcript: ENSMUST00000024238
AA Change: R755W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: R755W

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192235
SMART Domains Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
EGF 108 163 4.9e-5 SMART
EGF 168 201 2.6e-6 SMART
EGF_like 208 239 1.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194742
Predicted Effect probably damaging
Transcript: ENSMUST00000213524
AA Change: R755W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T C 2: 127,186,953 T109A probably damaging Het
4430402I18Rik T C 19: 28,927,689 H325R possibly damaging Het
9530053A07Rik T C 7: 28,140,183 F474L probably benign Het
A430005L14Rik GCC G 4: 153,960,953 probably null Het
Actr1a T C 19: 46,395,664 D5G possibly damaging Het
Adra2c A G 5: 35,280,873 T330A probably benign Het
Ahcyl2 C T 6: 29,859,698 probably benign Het
Ahnak T C 19: 9,007,175 V1941A probably damaging Het
Akr1b7 G A 6: 34,412,476 probably null Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ank2 A G 3: 126,953,226 V570A probably damaging Het
Ano4 T C 10: 89,112,840 E302G probably damaging Het
Bop1 A T 15: 76,455,289 H285Q probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Catsperb A T 12: 101,594,284 I845L possibly damaging Het
Ccdc28b G T 4: 129,619,445 Q184K probably damaging Het
Cd101 A G 3: 101,018,810 S198P probably damaging Het
Cdc7 A T 5: 106,969,297 probably null Het
Cdhr2 A G 13: 54,736,456 D1268G probably benign Het
Chrnb1 T A 11: 69,794,153 N117I probably damaging Het
Chst11 C A 10: 83,191,249 P170Q probably damaging Het
Clca3b A G 3: 144,847,171 Y98H probably damaging Het
Crnkl1 A G 2: 145,928,212 V237A possibly damaging Het
Ctnnbl1 G A 2: 157,817,832 probably null Het
Dbndd1 C A 8: 123,509,843 R95S probably damaging Het
Ddx3y A G Y: 1,265,965 V344A probably damaging Het
Defb30 A T 14: 63,036,110 probably null Het
Dnah17 C T 11: 118,127,282 R129Q probably benign Het
Dnhd1 A T 7: 105,713,684 M3818L probably benign Het
Dusp4 G T 8: 34,817,304 D258Y probably damaging Het
E2f1 A T 2: 154,564,448 F103I probably benign Het
Elavl2 T C 4: 91,260,818 Y248C probably damaging Het
Ephb3 T C 16: 21,219,105 V310A possibly damaging Het
Erbin A G 13: 103,857,409 probably null Het
Etv4 A T 11: 101,775,341 H120Q probably damaging Het
Fam45a T C 19: 60,834,836 L303P probably benign Het
Flot2 T A 11: 78,049,488 C20* probably null Het
Fsip2 G A 2: 82,990,918 G5665D probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Glrp1 TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG 1: 88,503,344 probably benign Het
Gm43302 A T 5: 105,280,089 L202* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hnf1b A T 11: 83,856,037 M160L probably damaging Het
Inhbe T C 10: 127,350,601 T237A possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kmt2c A T 5: 25,294,734 probably null Het
Kyat3 A G 3: 142,734,606 K364E probably benign Het
Lars T A 18: 42,216,959 T927S probably benign Het
Mfap1b A T 2: 121,473,890 M8K probably benign Het
Mroh8 G A 2: 157,228,656 P592S possibly damaging Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1215 A T 2: 89,002,196 L31M probably benign Het
Olfr1375 C T 11: 51,048,470 A121V probably damaging Het
Olfr645 T C 7: 104,084,891 Y63C probably benign Het
Pcdha8 T A 18: 36,993,734 V423E probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pde8a T C 7: 81,333,422 V791A probably damaging Het
Pds5a A G 5: 65,638,577 S657P probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Rad51d A G 11: 82,890,370 V17A possibly damaging Het
Sdc1 A T 12: 8,791,743 probably null Het
Sdcbp2 T A 2: 151,587,137 I152N probably damaging Het
Slc4a4 G T 5: 89,046,217 M141I probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spata6 T C 4: 111,799,118 C320R probably damaging Het
Ssu2 T A 6: 112,380,996 T129S probably damaging Het
Stat5a T A 11: 100,880,583 W631R probably damaging Het
Sult1c2 T A 17: 53,836,911 N122I possibly damaging Het
Synpo2 G A 3: 123,117,682 Q105* probably null Het
Tert G A 13: 73,639,243 V783I probably damaging Het
Ticam1 G T 17: 56,271,117 T326K probably benign Het
Tmem63b T C 17: 45,669,962 M269V possibly damaging Het
Tmem86a T A 7: 47,053,046 V73E possibly damaging Het
Trpv4 G A 5: 114,623,614 R818C possibly damaging Het
Tstd2 A G 4: 46,135,542 S4P probably benign Het
Ttn A T 2: 76,814,371 V4686E probably damaging Het
Ubash3b A G 9: 41,043,473 probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Usp33 A G 3: 152,384,187 E780G possibly damaging Het
Vapb T A 2: 173,771,543 Y78* probably null Het
Vps13b G A 15: 35,886,948 R3227Q probably damaging Het
Vps33a A T 5: 123,558,630 I320N probably damaging Het
Wnt5a T C 14: 28,522,770 C305R probably damaging Het
Zbtb38 A G 9: 96,687,643 C463R probably damaging Het
Zc3h12d G A 10: 7,866,326 C263Y probably damaging Het
Zfp971 G A 2: 178,033,733 R375Q probably damaging Het
Znrf1 T A 8: 111,619,194 probably null Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721 splice site probably benign
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525 splice site probably benign
Diminishment UTSW 9 108842708 intron probably benign
little_d UTSW 9 108827692 missense probably damaging 0.98
nogal UTSW 9 108835838 missense probably benign
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
PIT4243001:Celsr3 UTSW 9 108832308 missense probably benign 0.13
PIT4810001:Celsr3 UTSW 9 108845733 missense probably damaging 1.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1497:Celsr3 UTSW 9 108848865 missense probably benign 0.14
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108829068 missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108842952 nonsense probably null
R1753:Celsr3 UTSW 9 108831857 missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108828958 missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108842552 missense probably benign
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108837560 missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
R7061:Celsr3 UTSW 9 108847594 nonsense probably null
R7122:Celsr3 UTSW 9 108828567 missense possibly damaging 0.90
R7156:Celsr3 UTSW 9 108838004 missense possibly damaging 0.95
R7166:Celsr3 UTSW 9 108842951 missense probably damaging 1.00
R7176:Celsr3 UTSW 9 108845762 missense probably benign
R7213:Celsr3 UTSW 9 108849040 missense probably damaging 0.98
R7314:Celsr3 UTSW 9 108829144 missense probably damaging 1.00
R7478:Celsr3 UTSW 9 108843578 missense probably benign 0.37
R7508:Celsr3 UTSW 9 108836622 missense probably benign
R7554:Celsr3 UTSW 9 108841209 missense probably benign
R7615:Celsr3 UTSW 9 108837652 missense possibly damaging 0.75
R7653:Celsr3 UTSW 9 108835070 nonsense probably null
R7747:Celsr3 UTSW 9 108829978 missense possibly damaging 0.61
RF020:Celsr3 UTSW 9 108849057 missense probably benign
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTCTAACTGGTGTGGCATC -3'
(R):5'- TTGTAATCCAGCGGCAGAGC -3'

Sequencing Primer
(F):5'- ACCCTTTGTGATAAACAGTGCC -3'
(R):5'- AGAGCCAGTGTCACCAGG -3'
Posted On2016-09-06