Incidental Mutation 'R5396:Olfr1'
ID429690
Institutional Source Beutler Lab
Gene Symbol Olfr1
Ensembl Gene ENSMUSG00000069823
Gene Nameolfactory receptor 1
SynonymsI54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
MMRRC Submission 044394-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5396 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location73393010-73399614 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73395654 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T C 2: 127,186,953 T109A probably damaging Het
4430402I18Rik T C 19: 28,927,689 H325R possibly damaging Het
9530053A07Rik T C 7: 28,140,183 F474L probably benign Het
A430005L14Rik GCC G 4: 153,960,953 probably null Het
Actr1a T C 19: 46,395,664 D5G possibly damaging Het
Adra2c A G 5: 35,280,873 T330A probably benign Het
Ahcyl2 C T 6: 29,859,698 probably benign Het
Ahnak T C 19: 9,007,175 V1941A probably damaging Het
Akr1b7 G A 6: 34,412,476 probably null Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ank2 A G 3: 126,953,226 V570A probably damaging Het
Ano4 T C 10: 89,112,840 E302G probably damaging Het
Bop1 A T 15: 76,455,289 H285Q probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Catsperb A T 12: 101,594,284 I845L possibly damaging Het
Ccdc28b G T 4: 129,619,445 Q184K probably damaging Het
Cd101 A G 3: 101,018,810 S198P probably damaging Het
Cdc7 A T 5: 106,969,297 probably null Het
Cdhr2 A G 13: 54,736,456 D1268G probably benign Het
Celsr3 C T 9: 108,828,582 R755W probably damaging Het
Chrnb1 T A 11: 69,794,153 N117I probably damaging Het
Chst11 C A 10: 83,191,249 P170Q probably damaging Het
Clca3b A G 3: 144,847,171 Y98H probably damaging Het
Crnkl1 A G 2: 145,928,212 V237A possibly damaging Het
Ctnnbl1 G A 2: 157,817,832 probably null Het
Dbndd1 C A 8: 123,509,843 R95S probably damaging Het
Ddx3y A G Y: 1,265,965 V344A probably damaging Het
Defb30 A T 14: 63,036,110 probably null Het
Dnah17 C T 11: 118,127,282 R129Q probably benign Het
Dnhd1 A T 7: 105,713,684 M3818L probably benign Het
Dusp4 G T 8: 34,817,304 D258Y probably damaging Het
E2f1 A T 2: 154,564,448 F103I probably benign Het
Elavl2 T C 4: 91,260,818 Y248C probably damaging Het
Ephb3 T C 16: 21,219,105 V310A possibly damaging Het
Erbin A G 13: 103,857,409 probably null Het
Etv4 A T 11: 101,775,341 H120Q probably damaging Het
Fam45a T C 19: 60,834,836 L303P probably benign Het
Flot2 T A 11: 78,049,488 C20* probably null Het
Fsip2 G A 2: 82,990,918 G5665D probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Glrp1 TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG 1: 88,503,344 probably benign Het
Gm43302 A T 5: 105,280,089 L202* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hnf1b A T 11: 83,856,037 M160L probably damaging Het
Inhbe T C 10: 127,350,601 T237A possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kmt2c A T 5: 25,294,734 probably null Het
Kyat3 A G 3: 142,734,606 K364E probably benign Het
Lars T A 18: 42,216,959 T927S probably benign Het
Mfap1b A T 2: 121,473,890 M8K probably benign Het
Mroh8 G A 2: 157,228,656 P592S possibly damaging Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Olfr1215 A T 2: 89,002,196 L31M probably benign Het
Olfr1375 C T 11: 51,048,470 A121V probably damaging Het
Olfr645 T C 7: 104,084,891 Y63C probably benign Het
Pcdha8 T A 18: 36,993,734 V423E probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pde8a T C 7: 81,333,422 V791A probably damaging Het
Pds5a A G 5: 65,638,577 S657P probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Rad51d A G 11: 82,890,370 V17A possibly damaging Het
Sdc1 A T 12: 8,791,743 probably null Het
Sdcbp2 T A 2: 151,587,137 I152N probably damaging Het
Slc4a4 G T 5: 89,046,217 M141I probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spata6 T C 4: 111,799,118 C320R probably damaging Het
Ssu2 T A 6: 112,380,996 T129S probably damaging Het
Stat5a T A 11: 100,880,583 W631R probably damaging Het
Sult1c2 T A 17: 53,836,911 N122I possibly damaging Het
Synpo2 G A 3: 123,117,682 Q105* probably null Het
Tert G A 13: 73,639,243 V783I probably damaging Het
Ticam1 G T 17: 56,271,117 T326K probably benign Het
Tmem63b T C 17: 45,669,962 M269V possibly damaging Het
Tmem86a T A 7: 47,053,046 V73E possibly damaging Het
Trpv4 G A 5: 114,623,614 R818C possibly damaging Het
Tstd2 A G 4: 46,135,542 S4P probably benign Het
Ttn A T 2: 76,814,371 V4686E probably damaging Het
Ubash3b A G 9: 41,043,473 probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Usp33 A G 3: 152,384,187 E780G possibly damaging Het
Vapb T A 2: 173,771,543 Y78* probably null Het
Vps13b G A 15: 35,886,948 R3227Q probably damaging Het
Vps33a A T 5: 123,558,630 I320N probably damaging Het
Wnt5a T C 14: 28,522,770 C305R probably damaging Het
Zbtb38 A G 9: 96,687,643 C463R probably damaging Het
Zc3h12d G A 10: 7,866,326 C263Y probably damaging Het
Zfp971 G A 2: 178,033,733 R375Q probably damaging Het
Znrf1 T A 8: 111,619,194 probably null Het
Other mutations in Olfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Olfr1 APN 11 73395191 missense probably damaging 0.98
IGL01938:Olfr1 APN 11 73395645 missense probably damaging 1.00
IGL02270:Olfr1 APN 11 73395365 missense probably benign
IGL03287:Olfr1 APN 11 73396019 start codon destroyed probably null 1.00
R0006:Olfr1 UTSW 11 73395488 missense probably damaging 0.99
R0907:Olfr1 UTSW 11 73395119 missense probably damaging 0.97
R1982:Olfr1 UTSW 11 73395092 missense probably benign 0.00
R3804:Olfr1 UTSW 11 73395950 missense probably benign 0.01
R4064:Olfr1 UTSW 11 73395522 missense probably benign 0.04
R4171:Olfr1 UTSW 11 73395539 missense probably damaging 1.00
R4724:Olfr1 UTSW 11 73395155 missense probably damaging 1.00
R4732:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R4733:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R5030:Olfr1 UTSW 11 73395654 frame shift probably null
R5097:Olfr1 UTSW 11 73395293 missense probably damaging 1.00
R5098:Olfr1 UTSW 11 73395654 frame shift probably null
R5101:Olfr1 UTSW 11 73395654 frame shift probably null
R5135:Olfr1 UTSW 11 73395654 frame shift probably null
R5137:Olfr1 UTSW 11 73395654 frame shift probably null
R5192:Olfr1 UTSW 11 73395654 frame shift probably null
R5193:Olfr1 UTSW 11 73395653 frame shift probably null
R5193:Olfr1 UTSW 11 73395654 frame shift probably null
R5197:Olfr1 UTSW 11 73395654 frame shift probably null
R5220:Olfr1 UTSW 11 73395654 frame shift probably null
R5221:Olfr1 UTSW 11 73395654 frame shift probably null
R5222:Olfr1 UTSW 11 73395654 frame shift probably null
R5258:Olfr1 UTSW 11 73395654 frame shift probably null
R5297:Olfr1 UTSW 11 73395654 frame shift probably null
R5398:Olfr1 UTSW 11 73395654 frame shift probably null
R5399:Olfr1 UTSW 11 73395654 frame shift probably null
R5432:Olfr1 UTSW 11 73395654 frame shift probably null
R5433:Olfr1 UTSW 11 73395654 frame shift probably null
R5531:Olfr1 UTSW 11 73395177 missense probably benign 0.26
R5634:Olfr1 UTSW 11 73395654 frame shift probably null
R5714:Olfr1 UTSW 11 73395361 unclassified probably null
R5812:Olfr1 UTSW 11 73395654 frame shift probably null
R5813:Olfr1 UTSW 11 73395654 frame shift probably null
R5814:Olfr1 UTSW 11 73395654 frame shift probably null
R5815:Olfr1 UTSW 11 73395654 frame shift probably null
R5913:Olfr1 UTSW 11 73395654 frame shift probably null
R5955:Olfr1 UTSW 11 73395654 frame shift probably null
R5956:Olfr1 UTSW 11 73395654 frame shift probably null
R5968:Olfr1 UTSW 11 73395192 missense possibly damaging 0.75
R6029:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6176:Olfr1 UTSW 11 73395654 frame shift probably null
R6177:Olfr1 UTSW 11 73395654 frame shift probably null
R6178:Olfr1 UTSW 11 73395654 frame shift probably null
R6196:Olfr1 UTSW 11 73395473 missense probably benign 0.08
R6995:Olfr1 UTSW 11 73395584 missense probably benign
R7035:Olfr1 UTSW 11 73395718 missense probably benign 0.00
R7470:Olfr1 UTSW 11 73395888 missense probably damaging 1.00
R7530:Olfr1 UTSW 11 73388363 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATTAACACGGGTGTCAGAGCAG -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On2016-09-06