Incidental Mutation 'R5396:4430402I18Rik'
ID429717
Institutional Source Beutler Lab
Gene Symbol 4430402I18Rik
Ensembl Gene ENSMUSG00000064202
Gene NameRIKEN cDNA 4430402I18 gene
Synonyms
MMRRC Submission 044394-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5396 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location28893042-28967800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28927689 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 325 (H325R)
Ref Sequence ENSEMBL: ENSMUSP00000132800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025872] [ENSMUST00000160542] [ENSMUST00000162110] [ENSMUST00000164777] [ENSMUST00000175647]
Predicted Effect probably benign
Transcript: ENSMUST00000025872
AA Change: H339R

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025872
Gene: ENSMUSG00000064202
AA Change: H339R

DomainStartEndE-ValueType
Pfam:SPATA6 1 91 1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159655
Predicted Effect possibly damaging
Transcript: ENSMUST00000160542
AA Change: H322R

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124396
Gene: ENSMUSG00000064202
AA Change: H322R

DomainStartEndE-ValueType
Pfam:SPATA6 1 77 1e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162110
AA Change: H393R

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123818
Gene: ENSMUSG00000064202
AA Change: H393R

DomainStartEndE-ValueType
Pfam:SPATA6 7 145 7.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164777
AA Change: H325R

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132800
Gene: ENSMUSG00000064202
AA Change: H325R

DomainStartEndE-ValueType
Pfam:SPATA6 1 77 1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175647
SMART Domains Protein: ENSMUSP00000135813
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
Pfam:SPATA6 6 78 4.5e-22 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T C 2: 127,186,953 T109A probably damaging Het
9530053A07Rik T C 7: 28,140,183 F474L probably benign Het
A430005L14Rik GCC G 4: 153,960,953 probably null Het
Actr1a T C 19: 46,395,664 D5G possibly damaging Het
Adra2c A G 5: 35,280,873 T330A probably benign Het
Ahcyl2 C T 6: 29,859,698 probably benign Het
Ahnak T C 19: 9,007,175 V1941A probably damaging Het
Akr1b7 G A 6: 34,412,476 probably null Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ank2 A G 3: 126,953,226 V570A probably damaging Het
Ano4 T C 10: 89,112,840 E302G probably damaging Het
Bop1 A T 15: 76,455,289 H285Q probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Catsperb A T 12: 101,594,284 I845L possibly damaging Het
Ccdc28b G T 4: 129,619,445 Q184K probably damaging Het
Cd101 A G 3: 101,018,810 S198P probably damaging Het
Cdc7 A T 5: 106,969,297 probably null Het
Cdhr2 A G 13: 54,736,456 D1268G probably benign Het
Celsr3 C T 9: 108,828,582 R755W probably damaging Het
Chrnb1 T A 11: 69,794,153 N117I probably damaging Het
Chst11 C A 10: 83,191,249 P170Q probably damaging Het
Clca3b A G 3: 144,847,171 Y98H probably damaging Het
Crnkl1 A G 2: 145,928,212 V237A possibly damaging Het
Ctnnbl1 G A 2: 157,817,832 probably null Het
Dbndd1 C A 8: 123,509,843 R95S probably damaging Het
Ddx3y A G Y: 1,265,965 V344A probably damaging Het
Defb30 A T 14: 63,036,110 probably null Het
Dnah17 C T 11: 118,127,282 R129Q probably benign Het
Dnhd1 A T 7: 105,713,684 M3818L probably benign Het
Dusp4 G T 8: 34,817,304 D258Y probably damaging Het
E2f1 A T 2: 154,564,448 F103I probably benign Het
Elavl2 T C 4: 91,260,818 Y248C probably damaging Het
Ephb3 T C 16: 21,219,105 V310A possibly damaging Het
Erbin A G 13: 103,857,409 probably null Het
Etv4 A T 11: 101,775,341 H120Q probably damaging Het
Fam45a T C 19: 60,834,836 L303P probably benign Het
Flot2 T A 11: 78,049,488 C20* probably null Het
Fsip2 G A 2: 82,990,918 G5665D probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Glrp1 TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG 1: 88,503,344 probably benign Het
Gm43302 A T 5: 105,280,089 L202* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hnf1b A T 11: 83,856,037 M160L probably damaging Het
Inhbe T C 10: 127,350,601 T237A possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kmt2c A T 5: 25,294,734 probably null Het
Kyat3 A G 3: 142,734,606 K364E probably benign Het
Lars T A 18: 42,216,959 T927S probably benign Het
Mfap1b A T 2: 121,473,890 M8K probably benign Het
Mroh8 G A 2: 157,228,656 P592S possibly damaging Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1215 A T 2: 89,002,196 L31M probably benign Het
Olfr1375 C T 11: 51,048,470 A121V probably damaging Het
Olfr645 T C 7: 104,084,891 Y63C probably benign Het
Pcdha8 T A 18: 36,993,734 V423E probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pde8a T C 7: 81,333,422 V791A probably damaging Het
Pds5a A G 5: 65,638,577 S657P probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Rad51d A G 11: 82,890,370 V17A possibly damaging Het
Sdc1 A T 12: 8,791,743 probably null Het
Sdcbp2 T A 2: 151,587,137 I152N probably damaging Het
Slc4a4 G T 5: 89,046,217 M141I probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spata6 T C 4: 111,799,118 C320R probably damaging Het
Ssu2 T A 6: 112,380,996 T129S probably damaging Het
Stat5a T A 11: 100,880,583 W631R probably damaging Het
Sult1c2 T A 17: 53,836,911 N122I possibly damaging Het
Synpo2 G A 3: 123,117,682 Q105* probably null Het
Tert G A 13: 73,639,243 V783I probably damaging Het
Ticam1 G T 17: 56,271,117 T326K probably benign Het
Tmem63b T C 17: 45,669,962 M269V possibly damaging Het
Tmem86a T A 7: 47,053,046 V73E possibly damaging Het
Trpv4 G A 5: 114,623,614 R818C possibly damaging Het
Tstd2 A G 4: 46,135,542 S4P probably benign Het
Ttn A T 2: 76,814,371 V4686E probably damaging Het
Ubash3b A G 9: 41,043,473 probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Usp33 A G 3: 152,384,187 E780G possibly damaging Het
Vapb T A 2: 173,771,543 Y78* probably null Het
Vps13b G A 15: 35,886,948 R3227Q probably damaging Het
Vps33a A T 5: 123,558,630 I320N probably damaging Het
Wnt5a T C 14: 28,522,770 C305R probably damaging Het
Zbtb38 A G 9: 96,687,643 C463R probably damaging Het
Zc3h12d G A 10: 7,866,326 C263Y probably damaging Het
Zfp971 G A 2: 178,033,733 R375Q probably damaging Het
Znrf1 T A 8: 111,619,194 probably null Het
Other mutations in 4430402I18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:4430402I18Rik APN 19 28959673 intron probably benign
IGL01115:4430402I18Rik APN 19 28944442 unclassified probably null
IGL01520:4430402I18Rik APN 19 28896132 splice site probably null
R1104:4430402I18Rik UTSW 19 28967632 start codon destroyed probably null 0.99
R1434:4430402I18Rik UTSW 19 28927639 splice site probably benign
R1850:4430402I18Rik UTSW 19 28939171 critical splice acceptor site probably null
R1992:4430402I18Rik UTSW 19 28948624 missense probably damaging 1.00
R4042:4430402I18Rik UTSW 19 28945783 missense possibly damaging 0.83
R4043:4430402I18Rik UTSW 19 28945783 missense possibly damaging 0.83
R4044:4430402I18Rik UTSW 19 28945783 missense possibly damaging 0.83
R4845:4430402I18Rik UTSW 19 28927748 missense probably benign
R4911:4430402I18Rik UTSW 19 28897503 critical splice donor site probably benign
R4933:4430402I18Rik UTSW 19 28941775 missense possibly damaging 0.86
R5213:4430402I18Rik UTSW 19 28963564 missense probably benign 0.22
R6898:4430402I18Rik UTSW 19 28944288 missense probably benign 0.01
R7530:4430402I18Rik UTSW 19 28948721 nonsense probably null
R7883:4430402I18Rik UTSW 19 28928613 missense probably benign 0.09
R7966:4430402I18Rik UTSW 19 28928613 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTCACCGCTTATCAGTGTTCC -3'
(R):5'- TTCCTCTCTGAGAGCTCTGG -3'

Sequencing Primer
(F):5'- AGTGTTCCACTGAGCAGGG -3'
(R):5'- ATCTCCTTAAGATGGAAAGAGGG -3'
Posted On2016-09-06