Incidental Mutation 'R5397:Kdm5b'
ID 429723
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission 042968-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.356) question?
Stock # R5397 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 134549836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000047714
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112198
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191572
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 (GRCm38) T518A probably benign Het
Acvr1b T A 15: 101,096,845 (GRCm39) V254D probably damaging Het
Adar T C 3: 89,642,626 (GRCm39) I169T probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Arap1 A T 7: 101,034,119 (GRCm39) Q187L possibly damaging Het
Atad5 T A 11: 80,002,319 (GRCm39) M1037K probably damaging Het
Bsg T A 10: 79,544,629 (GRCm39) W56R probably damaging Het
C1qtnf3 A G 15: 10,978,627 (GRCm39) T276A probably damaging Het
Capn2 A G 1: 182,298,271 (GRCm39) C665R probably damaging Het
Cast A G 13: 74,869,056 (GRCm39) S248P possibly damaging Het
Cd68 C T 11: 69,556,484 (GRCm39) V108I probably benign Het
Cyp2d11 A T 15: 82,276,279 (GRCm39) W131R probably damaging Het
Dhx58 A G 11: 100,594,746 (GRCm39) V50A probably damaging Het
Fam124a A G 14: 62,843,838 (GRCm39) S449G probably benign Het
Flnc G A 6: 29,441,160 (GRCm39) M371I possibly damaging Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gpr149 A G 3: 62,438,226 (GRCm39) S644P probably damaging Het
Gucy1b1 G A 3: 81,951,458 (GRCm39) T274I possibly damaging Het
Kcnq5 A G 1: 21,476,080 (GRCm39) V541A probably damaging Het
Lig4 G T 8: 10,022,644 (GRCm39) R379S probably benign Het
Map7 G A 10: 20,149,067 (GRCm39) R514Q unknown Het
Mertk T A 2: 128,613,384 (GRCm39) F467I possibly damaging Het
Mettl4 A T 17: 95,034,705 (GRCm39) Y463* probably null Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Nme8 T C 13: 19,878,549 (GRCm39) D70G probably damaging Het
Npat A G 9: 53,481,774 (GRCm39) N1161D probably damaging Het
Or4k77 T A 2: 111,199,285 (GRCm39) C103S probably benign Het
Or51ac3 T A 7: 103,213,713 (GRCm39) I258F probably damaging Het
Or6c76b T C 10: 129,692,579 (GRCm39) F64S probably damaging Het
Paxip1 A T 5: 27,977,002 (GRCm39) probably benign Het
Peg10 C CTCG 6: 4,756,453 (GRCm39) probably benign Het
Plxnc1 T C 10: 94,679,614 (GRCm39) T923A probably benign Het
Pms1 T A 1: 53,231,279 (GRCm39) K857* probably null Het
Ppp1r9b A G 11: 94,892,936 (GRCm39) E260G probably damaging Het
Prpf3 A T 3: 95,760,891 (GRCm39) S4T probably benign Het
Rdh14 T A 12: 10,444,869 (GRCm39) V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 138,680,599 (GRCm39) probably benign Het
S100a1 A T 3: 90,419,442 (GRCm39) M1K probably null Het
Slc2a5 G A 4: 150,224,280 (GRCm39) probably null Het
Slc5a5 T C 8: 71,343,823 (GRCm39) T160A probably damaging Het
Srcap T G 7: 127,152,468 (GRCm39) probably null Het
Tgm6 T A 2: 129,983,828 (GRCm39) M329K possibly damaging Het
Tom1l1 G A 11: 90,552,600 (GRCm39) A201V probably benign Het
Trgv5 A C 13: 19,376,728 (GRCm39) E42D possibly damaging Het
Ttc13 T C 8: 125,402,002 (GRCm39) T662A possibly damaging Het
Ttn T C 2: 76,555,599 (GRCm39) T30469A probably damaging Het
Ube3a T A 7: 58,936,660 (GRCm39) S645R probably benign Het
Vgll2 A G 10: 51,901,262 (GRCm39) E64G probably damaging Het
Vmn1r25 A T 6: 57,956,060 (GRCm39) C76* probably null Het
Vmn2r101 A G 17: 19,809,104 (GRCm39) N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,223,344 (GRCm39) probably benign Het
Zcchc7 C A 4: 44,926,048 (GRCm39) A28E probably damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAAGTCTGTTTCACCATTGGCTC -3'
(R):5'- CTCATTAATGCCAGGCAAGGG -3'

Sequencing Primer
(F):5'- GGCTCTGTTTTCTCTTACATTAGG -3'
(R):5'- AGGCAAGGGCTTTACCACTG -3'
Posted On 2016-09-06