Incidental Mutation 'R5397:Tgm6'
ID429729
Institutional Source Beutler Lab
Gene Symbol Tgm6
Ensembl Gene ENSMUSG00000027403
Gene Nametransglutaminase 6
SynonymsTGM3L
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130112416-130154232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130141908 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 329 (M329K)
Ref Sequence ENSEMBL: ENSMUSP00000028888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028888
AA Change: M329K

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028888
Gene: ENSMUSG00000027403
AA Change: M329K

DomainStartEndE-ValueType
Pfam:Transglut_N 5 119 3e-31 PFAM
TGc 266 359 3.48e-40 SMART
low complexity region 466 483 N/A INTRINSIC
Pfam:Transglut_C 495 600 2.4e-23 PFAM
Pfam:Transglut_C 607 704 4.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147616
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the transglutaminase superfamily. It catalyzes the cross-linking of proteins and the conjugation of polyamines to proteins. Mutations in this gene are associated with spinocerebellar ataxia type 35 (SCA35). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Tgm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Tgm6 APN 2 130136495 missense probably benign 0.00
IGL01331:Tgm6 APN 2 130143618 splice site probably null
IGL01348:Tgm6 APN 2 130137379 missense probably damaging 1.00
IGL01787:Tgm6 APN 2 130151434 splice site probably benign
IGL02208:Tgm6 APN 2 130135870 missense probably benign 0.11
IGL02656:Tgm6 APN 2 130145103 missense probably damaging 1.00
IGL03280:Tgm6 APN 2 130138931 missense probably damaging 1.00
R0200:Tgm6 UTSW 2 130152945 splice site probably null
R0507:Tgm6 UTSW 2 130138831 missense possibly damaging 0.56
R0744:Tgm6 UTSW 2 130151761 missense probably benign 0.00
R0800:Tgm6 UTSW 2 130143422 missense possibly damaging 0.94
R1530:Tgm6 UTSW 2 130151282 missense possibly damaging 0.71
R1573:Tgm6 UTSW 2 130151740 missense probably benign 0.00
R1706:Tgm6 UTSW 2 130145159 missense possibly damaging 0.53
R2330:Tgm6 UTSW 2 130143242 missense probably damaging 1.00
R2881:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R2882:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R3622:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R3624:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R4370:Tgm6 UTSW 2 130143605 missense probably benign 0.12
R4664:Tgm6 UTSW 2 130137394 missense probably benign 0.05
R4664:Tgm6 UTSW 2 130141208 missense probably benign 0.34
R4983:Tgm6 UTSW 2 130141193 missense probably damaging 0.99
R5182:Tgm6 UTSW 2 130141302 missense probably damaging 0.98
R5411:Tgm6 UTSW 2 130145196 missense probably benign 0.01
R5683:Tgm6 UTSW 2 130138955 missense probably damaging 1.00
R5933:Tgm6 UTSW 2 130141256 missense probably damaging 1.00
R6016:Tgm6 UTSW 2 130141228 missense probably damaging 0.99
R7252:Tgm6 UTSW 2 130144964 missense probably damaging 1.00
R7290:Tgm6 UTSW 2 130141190 missense probably damaging 1.00
R7581:Tgm6 UTSW 2 130141285 missense probably damaging 1.00
R8143:Tgm6 UTSW 2 130141843 missense probably damaging 0.98
R8153:Tgm6 UTSW 2 130145055 missense probably benign 0.00
R8219:Tgm6 UTSW 2 130151280 missense probably benign
R8297:Tgm6 UTSW 2 130137438 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTAGGACCTCCACAGTGG -3'
(R):5'- TTAAGGGGCAGTGAAACTCCC -3'

Sequencing Primer
(F):5'- TCCACAGTGGAGAGACTAGG -3'
(R):5'- GCAGTGAAACTCCCTTGGG -3'
Posted On2016-09-06