Incidental Mutation 'R5397:Gpr149'
ID429730
Institutional Source Beutler Lab
Gene Symbol Gpr149
Ensembl Gene ENSMUSG00000043441
Gene NameG protein-coupled receptor 149
SynonymsPGR10, R35, Ieda, 9630018L10Rik
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location62529077-62605140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62530805 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 644 (S644P)
Ref Sequence ENSEMBL: ENSMUSP00000060893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058535]
Predicted Effect probably damaging
Transcript: ENSMUST00000058535
AA Change: S644P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060893
Gene: ENSMUSG00000043441
AA Change: S644P

DomainStartEndE-ValueType
Pfam:7tm_1 52 363 7.2e-7 PFAM
coiled coil region 694 730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit increased fertility with increased litter size and frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Gpr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Gpr149 APN 3 62530673 missense probably damaging 1.00
IGL01339:Gpr149 APN 3 62604297 missense probably damaging 1.00
IGL01399:Gpr149 APN 3 62604431 missense probably damaging 1.00
IGL01954:Gpr149 APN 3 62530927 missense probably benign 0.36
IGL02115:Gpr149 APN 3 62594915 missense probably benign 0.02
IGL02218:Gpr149 APN 3 62530531 utr 3 prime probably benign
IGL02592:Gpr149 APN 3 62603810 missense possibly damaging 0.75
IGL03393:Gpr149 APN 3 62603945 missense probably benign 0.15
R0578:Gpr149 UTSW 3 62602689 missense possibly damaging 0.81
R1173:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1174:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1175:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1432:Gpr149 UTSW 3 62531018 missense probably damaging 1.00
R1484:Gpr149 UTSW 3 62595171 missense probably benign 0.00
R1972:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R1973:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R2180:Gpr149 UTSW 3 62604068 missense probably damaging 1.00
R2241:Gpr149 UTSW 3 62604053 missense probably benign 0.00
R3118:Gpr149 UTSW 3 62595022 missense probably benign 0.00
R3547:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R3548:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R4206:Gpr149 UTSW 3 62604503 missense possibly damaging 0.92
R4332:Gpr149 UTSW 3 62604373 missense possibly damaging 0.93
R4531:Gpr149 UTSW 3 62602678 missense probably benign 0.00
R4557:Gpr149 UTSW 3 62530870 missense probably damaging 1.00
R4557:Gpr149 UTSW 3 62604497 missense probably benign 0.02
R4593:Gpr149 UTSW 3 62602730 intron probably benign
R6592:Gpr149 UTSW 3 62530540 missense probably benign 0.02
R6642:Gpr149 UTSW 3 62530574 missense probably damaging 1.00
R6845:Gpr149 UTSW 3 62604521 missense possibly damaging 0.58
R7303:Gpr149 UTSW 3 62595070 missense possibly damaging 0.59
R7659:Gpr149 UTSW 3 62603835 missense probably benign 0.01
R7682:Gpr149 UTSW 3 62530739 missense probably damaging 1.00
R7803:Gpr149 UTSW 3 62530715 missense probably damaging 1.00
R7904:Gpr149 UTSW 3 62594935 missense probably benign 0.00
R7943:Gpr149 UTSW 3 62530711 missense probably damaging 1.00
Z1177:Gpr149 UTSW 3 62603959 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGATCTCTTCCTGGTAGCC -3'
(R):5'- TTATGAGGTCAGCGCAGAAG -3'

Sequencing Primer
(F):5'- GGTAGCCATCCCTCTCTTCATG -3'
(R):5'- GATAACCCCAGCCTCTAAGAAAATAG -3'
Posted On2016-09-06