Incidental Mutation 'R5397:Gucy1b1'
ID429731
Institutional Source Beutler Lab
Gene Symbol Gucy1b1
Ensembl Gene ENSMUSG00000028005
Gene Nameguanylate cyclase 1, soluble, beta 1
Synonymsbeta 1 sGC
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location82032006-82074689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82044151 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 274 (T274I)
Ref Sequence ENSEMBL: ENSMUSP00000142119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029635] [ENSMUST00000193597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029635
AA Change: T274I

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029635
Gene: ENSMUSG00000028005
AA Change: T274I

DomainStartEndE-ValueType
Pfam:HNOB 2 166 3.4e-58 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 586 3.53e-93 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193597
AA Change: T274I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142119
Gene: ENSMUSG00000028005
AA Change: T274I

DomainStartEndE-ValueType
Pfam:HNOB 1 172 1.5e-67 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 582 1.71e-91 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the soluble guanylate cyclase (sGC), which catalyzes the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate). The encoded protein contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice that bypass neonatal lethality die prematurely due to severe gastrointestinal obstruction and exhibit hypertension, reduced heart rate, lack of glycerol trinitrate-induced drop in systolic pressure, and lack of a nitric oxide effect on aortic relaxation and platelet aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Gucy1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gucy1b1 APN 3 82034862 missense probably damaging 1.00
IGL01602:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01603:Gucy1b1 APN 3 82034868 missense probably damaging 0.98
IGL01605:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01685:Gucy1b1 APN 3 82035285 missense probably benign 0.27
IGL01844:Gucy1b1 APN 3 82046526 missense possibly damaging 0.95
IGL02566:Gucy1b1 APN 3 82058329 missense probably damaging 1.00
R0014:Gucy1b1 UTSW 3 82039861 missense probably damaging 1.00
R0068:Gucy1b1 UTSW 3 82034878 missense probably benign 0.34
R0115:Gucy1b1 UTSW 3 82034391 missense probably benign
R0126:Gucy1b1 UTSW 3 82037911 splice site probably benign
R0277:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0323:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0633:Gucy1b1 UTSW 3 82045460 missense probably benign 0.02
R0691:Gucy1b1 UTSW 3 82045634 splice site probably benign
R0811:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R0812:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R1670:Gucy1b1 UTSW 3 82045460 missense probably benign 0.10
R1687:Gucy1b1 UTSW 3 82038042 missense probably damaging 1.00
R1856:Gucy1b1 UTSW 3 82058352 missense probably benign 0.00
R1950:Gucy1b1 UTSW 3 82045409 missense probably benign 0.43
R1995:Gucy1b1 UTSW 3 82034853 missense probably damaging 1.00
R2156:Gucy1b1 UTSW 3 82061020 missense probably benign
R2441:Gucy1b1 UTSW 3 82045454 missense probably damaging 0.98
R5014:Gucy1b1 UTSW 3 82046667 missense probably benign 0.43
R5494:Gucy1b1 UTSW 3 82039876 missense probably damaging 1.00
R6003:Gucy1b1 UTSW 3 82058277 missense probably damaging 1.00
R6088:Gucy1b1 UTSW 3 82034880 missense probably damaging 1.00
R6216:Gucy1b1 UTSW 3 82046713 splice site probably null
R6331:Gucy1b1 UTSW 3 82034411 missense possibly damaging 0.75
R6671:Gucy1b1 UTSW 3 82034408 missense probably benign
R6753:Gucy1b1 UTSW 3 82039747 missense probably null 0.03
R7150:Gucy1b1 UTSW 3 82043162 missense probably damaging 1.00
R7228:Gucy1b1 UTSW 3 82033274 missense unknown
R7461:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7501:Gucy1b1 UTSW 3 82035359 missense probably damaging 1.00
R7613:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7791:Gucy1b1 UTSW 3 82035397 nonsense probably null
Z1177:Gucy1b1 UTSW 3 82061112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCCAGCCATACACTTG -3'
(R):5'- AGCTTAATTGCAAGACCAATGG -3'

Sequencing Primer
(F):5'- TCATTCTCATCAGCTGACAGAGG -3'
(R):5'- GGCTAATCGTAAGTCAACCTAGCTG -3'
Posted On2016-09-06