Incidental Mutation 'R5397:Adar'
ID429732
Institutional Source Beutler Lab
Gene Symbol Adar
Ensembl Gene ENSMUSG00000027951
Gene Nameadenosine deaminase, RNA-specific
SynonymsAdar1p150, ADAR1, mZaADAR, Adar1p110
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89715022-89753446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89735319 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 169 (I169T)
Ref Sequence ENSEMBL: ENSMUSP00000103028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029563] [ENSMUST00000098924] [ENSMUST00000107405] [ENSMUST00000118341] [ENSMUST00000121094]
Predicted Effect probably benign
Transcript: ENSMUST00000029563
AA Change: I169T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029563
Gene: ENSMUSG00000027951
AA Change: I169T

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
ADEAMc 762 1145 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098924
SMART Domains Protein: ENSMUSP00000096525
Gene: ENSMUSG00000027951

DomainStartEndE-ValueType
Zalpha 1 64 3.1e-24 SMART
low complexity region 74 89 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
DSRM 209 275 3.6e-21 SMART
DSRM 320 386 4.36e-20 SMART
DSRM 428 494 1.58e-17 SMART
low complexity region 515 526 N/A INTRINSIC
ADEAMc 540 923 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107405
AA Change: I169T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103028
Gene: ENSMUSG00000027951
AA Change: I169T

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
low complexity region 763 774 N/A INTRINSIC
ADEAMc 788 1171 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118341
SMART Domains Protein: ENSMUSP00000113453
Gene: ENSMUSG00000027951

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
low complexity region 245 256 N/A INTRINSIC
ADEAMc 270 653 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121094
SMART Domains Protein: ENSMUSP00000112969
Gene: ENSMUSG00000027951

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
ADEAMc 244 627 3.74e-205 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150637
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice die during gestation. Inactivation of this locus has been associated with increased apoptosis and, in some lines, defects in both primitive and definitive hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Adar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Adar APN 3 89730840 critical splice donor site probably null
IGL01743:Adar APN 3 89745440 nonsense probably null
IGL01982:Adar APN 3 89738090 missense probably benign 0.03
Hellfire UTSW 3 89747575 missense probably damaging 1.00
logimen UTSW 3 89730814 missense probably benign 0.04
red UTSW 3 89750651 missense probably damaging 1.00
R0153:Adar UTSW 3 89730814 missense probably benign 0.04
R0464:Adar UTSW 3 89735582 missense possibly damaging 0.90
R0674:Adar UTSW 3 89749823 intron probably benign
R0762:Adar UTSW 3 89739983 splice site probably benign
R1567:Adar UTSW 3 89735781 missense probably benign 0.19
R1807:Adar UTSW 3 89734865 missense probably benign 0.00
R1858:Adar UTSW 3 89739282 missense probably benign 0.01
R1964:Adar UTSW 3 89745895 missense probably benign 0.23
R2440:Adar UTSW 3 89734854 missense possibly damaging 0.86
R3731:Adar UTSW 3 89746655 missense probably damaging 0.99
R3854:Adar UTSW 3 89736258 missense probably damaging 1.00
R4005:Adar UTSW 3 89749787 missense probably damaging 1.00
R4105:Adar UTSW 3 89740094 missense probably benign 0.00
R4693:Adar UTSW 3 89735940 missense probably damaging 1.00
R4980:Adar UTSW 3 89730814 missense probably benign 0.04
R5096:Adar UTSW 3 89747291 makesense probably null
R5199:Adar UTSW 3 89745944 missense probably damaging 1.00
R5406:Adar UTSW 3 89736111 missense probably damaging 1.00
R5411:Adar UTSW 3 89739212 missense probably benign 0.39
R5446:Adar UTSW 3 89740179 missense probably damaging 1.00
R5660:Adar UTSW 3 89735594 missense probably damaging 1.00
R5724:Adar UTSW 3 89735169 missense probably benign
R6087:Adar UTSW 3 89745590 missense probably benign 0.05
R6935:Adar UTSW 3 89747218 missense probably benign 0.00
R7644:Adar UTSW 3 89745519 missense probably benign 0.00
R7893:Adar UTSW 3 89750651 missense probably damaging 1.00
R8018:Adar UTSW 3 89747575 missense probably damaging 1.00
R8053:Adar UTSW 3 89747285 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGACTCTCAGAAATCAGGGG -3'
(R):5'- ACTGTCCAAACCAGGCTCTC -3'

Sequencing Primer
(F):5'- TCTCAGAAATCAGGGGTTCCACATAG -3'
(R):5'- AAACCAGGCTCTCCTCTAGGG -3'
Posted On2016-09-06