Incidental Mutation 'R5397:S100a1'
ID429733
Institutional Source Beutler Lab
Gene Symbol S100a1
Ensembl Gene ENSMUSG00000044080
Gene NameS100 calcium binding protein A1
SynonymsS100a, S100
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90511034-90514392 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 90512135 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000058237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001043] [ENSMUST00000048138] [ENSMUST00000049937] [ENSMUST00000060738] [ENSMUST00000076639] [ENSMUST00000107340] [ENSMUST00000107342] [ENSMUST00000107343] [ENSMUST00000107344] [ENSMUST00000107346] [ENSMUST00000131868] [ENSMUST00000146740]
Predicted Effect probably benign
Transcript: ENSMUST00000001043
SMART Domains Protein: ENSMUSP00000001043
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048138
SMART Domains Protein: ENSMUSP00000047737
Gene: ENSMUSG00000042312

DomainStartEndE-ValueType
Pfam:S_100 71 113 4.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049937
SMART Domains Protein: ENSMUSP00000061800
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
FoP_duplication 158 246 3.35e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060738
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058237
Gene: ENSMUSG00000044080
AA Change: M1K

DomainStartEndE-ValueType
Pfam:S_100 5 47 5.8e-23 PFAM
Pfam:EF-hand_1 54 82 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076639
SMART Domains Protein: ENSMUSP00000075936
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
Blast:FoP_duplication 59 84 3e-6 BLAST
low complexity region 86 108 N/A INTRINSIC
FoP_duplication 114 199 1.21e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107340
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102963
Gene: ENSMUSG00000044080
AA Change: M1K

DomainStartEndE-ValueType
Pfam:S_100 5 48 1.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107342
SMART Domains Protein: ENSMUSP00000102965
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Blast:FoP_duplication 34 59 3e-6 BLAST
low complexity region 61 83 N/A INTRINSIC
FoP_duplication 89 174 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107343
SMART Domains Protein: ENSMUSP00000102966
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
FoP_duplication 90 175 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107344
SMART Domains Protein: ENSMUSP00000102967
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107346
SMART Domains Protein: ENSMUSP00000102969
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
FoP_duplication 115 200 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131868
SMART Domains Protein: ENSMUSP00000123448
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146740
SMART Domains Protein: ENSMUSP00000116945
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 139 159 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous and heterozygous mice exhibit a reduced cardiac contractility in response to chronic hemodynamic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in S100a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1061:S100a1 UTSW 3 90511312 missense probably damaging 0.96
R1183:S100a1 UTSW 3 90511334 missense probably benign
R1766:S100a1 UTSW 3 90511292 missense probably damaging 1.00
R2282:S100a1 UTSW 3 90511292 missense probably damaging 1.00
R4615:S100a1 UTSW 3 90511255 missense possibly damaging 0.63
R7852:S100a1 UTSW 3 90512085 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTGTGACAAGCTGGGAAC -3'
(R):5'- GTGCTAGGGTTTCTCCTACACTG -3'

Sequencing Primer
(F):5'- ATTTGAGTTCAAGGCCAGCC -3'
(R):5'- AGGGTTTCTCCTACACTGCAAAATC -3'
Posted On2016-09-06