Incidental Mutation 'R5397:Prpf3'
ID 429734
Institutional Source Beutler Lab
Gene Symbol Prpf3
Ensembl Gene ENSMUSG00000015748
Gene Name pre-mRNA processing factor 3
Synonyms
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5397 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 95830124-95855885 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95853579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 4 (S4T)
Ref Sequence ENSEMBL: ENSMUSP00000124302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015892] [ENSMUST00000160109] [ENSMUST00000161476]
AlphaFold Q922U1
Predicted Effect probably benign
Transcript: ENSMUST00000015892
AA Change: S4T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000015892
Gene: ENSMUSG00000015748
AA Change: S4T

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 308 521 1.3e-82 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 544 673 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160109
AA Change: S4T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124302
Gene: ENSMUSG00000015748
AA Change: S4T

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161073
Predicted Effect probably benign
Transcript: ENSMUST00000161476
AA Change: S4T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000124950
Gene: ENSMUSG00000015748
AA Change: S4T

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 307 522 5.4e-74 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 543 674 3.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180383
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The removal of introns from nuclear pre-mRNAs occurs on complexes called spliceosomes, which are made up of 4 small nuclear ribonucleoprotein (snRNP) particles and an undefined number of transiently associated splicing factors. This gene product is one of several proteins that associate with U4 and U6 snRNPs. Mutations in this gene are associated with retinitis pigmentosa-18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Prpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02175:Prpf3 APN 3 95834107 missense probably damaging 0.99
IGL02825:Prpf3 APN 3 95853480 missense probably damaging 1.00
R0940:Prpf3 UTSW 3 95844223 missense probably damaging 1.00
R1542:Prpf3 UTSW 3 95836470 missense probably benign 0.08
R1545:Prpf3 UTSW 3 95847803 missense probably damaging 0.99
R2063:Prpf3 UTSW 3 95844239 missense probably benign
R2084:Prpf3 UTSW 3 95848989 missense probably benign 0.44
R2160:Prpf3 UTSW 3 95845230 missense probably benign 0.19
R3110:Prpf3 UTSW 3 95849800 intron probably benign
R3112:Prpf3 UTSW 3 95849800 intron probably benign
R4636:Prpf3 UTSW 3 95834170 missense probably damaging 0.99
R4671:Prpf3 UTSW 3 95851664 missense possibly damaging 0.76
R4689:Prpf3 UTSW 3 95836489 nonsense probably null
R4702:Prpf3 UTSW 3 95834092 missense probably damaging 0.97
R5080:Prpf3 UTSW 3 95833797 missense probably benign 0.45
R5177:Prpf3 UTSW 3 95849724 intron probably benign
R5290:Prpf3 UTSW 3 95853545 missense probably benign 0.39
R6329:Prpf3 UTSW 3 95832578 missense probably damaging 1.00
R7133:Prpf3 UTSW 3 95833740 splice site probably null
R8433:Prpf3 UTSW 3 95851651 missense probably damaging 1.00
R8725:Prpf3 UTSW 3 95840709 missense possibly damaging 0.48
X0063:Prpf3 UTSW 3 95840715 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTCCTAACAGGGACAACC -3'
(R):5'- CTTCATATGAAGTGGAGAGATGTGC -3'

Sequencing Primer
(F):5'- CAACCTGGGGAAGTTCAAATC -3'
(R):5'- TGCTTGGGGTTGAAAATAGGAATG -3'
Posted On 2016-09-06