Incidental Mutation 'R5397:Slc2a5'
ID429736
Institutional Source Beutler Lab
Gene Symbol Slc2a5
Ensembl Gene ENSMUSG00000028976
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 5
SynonymsGLUT5
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150119283-150144169 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 150139823 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030826]
Predicted Effect probably null
Transcript: ENSMUST00000030826
SMART Domains Protein: ENSMUSP00000030826
Gene: ENSMUSG00000028976

DomainStartEndE-ValueType
Pfam:MFS_1 16 397 1e-19 PFAM
Pfam:Sugar_tr 19 474 2.1e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151504
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a fructose transporter responsible for fructose uptake by the small intestine. The encoded protein also is necessary for the increase in blood pressure due to high dietary fructose consumption. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cochlear morphology and physiology with no detectable alterations in outer hair cell morphology, electromotility or nonlinear capacitance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Slc2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Slc2a5 APN 4 150125656 missense probably damaging 1.00
IGL01071:Slc2a5 APN 4 150120733 utr 5 prime probably benign
IGL01977:Slc2a5 APN 4 150142218 missense probably damaging 0.97
IGL03271:Slc2a5 APN 4 150135583 missense probably damaging 1.00
BB006:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
BB016:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R0760:Slc2a5 UTSW 4 150139667 missense probably benign
R0906:Slc2a5 UTSW 4 150142830 missense probably benign 0.21
R1099:Slc2a5 UTSW 4 150142179 missense probably benign 0.01
R1809:Slc2a5 UTSW 4 150143057 missense probably damaging 1.00
R2099:Slc2a5 UTSW 4 150143177 nonsense probably null
R2152:Slc2a5 UTSW 4 150125638 missense probably damaging 1.00
R2253:Slc2a5 UTSW 4 150139990 missense possibly damaging 0.78
R2696:Slc2a5 UTSW 4 150120746 missense probably benign
R4835:Slc2a5 UTSW 4 150140005 missense probably benign 0.06
R4926:Slc2a5 UTSW 4 150120742 nonsense probably null
R5123:Slc2a5 UTSW 4 150139805 nonsense probably null
R6209:Slc2a5 UTSW 4 150143100 missense probably benign 0.00
R6342:Slc2a5 UTSW 4 150139526 missense possibly damaging 0.93
R6547:Slc2a5 UTSW 4 150135619 missense possibly damaging 0.94
R7340:Slc2a5 UTSW 4 150139982 missense probably benign 0.44
R7507:Slc2a5 UTSW 4 150125650 missense probably damaging 1.00
R7537:Slc2a5 UTSW 4 150129069 missense possibly damaging 0.89
R7572:Slc2a5 UTSW 4 150142185 missense probably benign 0.33
R7751:Slc2a5 UTSW 4 150143134 missense probably damaging 1.00
R7929:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R8058:Slc2a5 UTSW 4 150143133 missense probably damaging 1.00
R8318:Slc2a5 UTSW 4 150139658 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGACGTGCACCTAGAGATGG -3'
(R):5'- ACTCTTGGTGGCTTAAGGGACC -3'

Sequencing Primer
(F):5'- TGCACCTAGAGATGGAGGAGATC -3'
(R):5'- TGGTCATGAACACATTGACGGC -3'
Posted On2016-09-06