Mutagenetix > Incidental Mutation

Incidental Mutation 'R5397:Ube3a'

429742

Institutional Source

Beutler Lab

Gene Symbol

Ube3a

Ensembl Gene

ENSMUSG00000025326

Gene Name

ubiquitin protein ligase E3A

Synonyms

Hpve6a, 5830462N02Rik, E6-AP ubiquitin protein ligase, A130086L21Rik

MMRRC Submission

042968-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.653) question?

Stock #

R5397 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59228750-59311536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59286912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 645 (S645R)

Ref Sequence

ENSEMBL: ENSMUSP00000143962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107537] [ENSMUST00000200758] [ENSMUST00000202945]

AlphaFold

O08759

Predicted Effect

probably benign
Transcript: ENSMUST00000107537
AA Change: S645R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103161
Gene: ENSMUSG00000025326
AA Change: S645R

Domain	Start	End	E-Value	Type
Pfam:AZUL	27	81	1.7e-21	PFAM
Blast:HECTc	108	169	2e-20	BLAST
low complexity region	170	207	N/A	INTRINSIC
Blast:HECTc	359	480	1e-12	BLAST
HECTc	540	870	5.05e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200758
AA Change: S666R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000143859
Gene: ENSMUSG00000025326
AA Change: S666R

Domain	Start	End	E-Value	Type
Pfam:AZUL	27	81	1.7e-21	PFAM
Blast:HECTc	108	169	2e-20	BLAST
low complexity region	170	207	N/A	INTRINSIC
Blast:HECTc	359	480	1e-12	BLAST
HECTc	540	870	5.05e-180	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202207

Predicted Effect

probably benign
Transcript: ENSMUST00000202247

Predicted Effect

probably benign
Transcript: ENSMUST00000202288

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202776

Predicted Effect

probably benign
Transcript: ENSMUST00000202945
AA Change: S645R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000143962
Gene: ENSMUSG00000025326
AA Change: S645R

Domain	Start	End	E-Value	Type
Pfam:AZUL	6	60	4.4e-21	PFAM
Blast:HECTc	87	148	2e-20	BLAST
low complexity region	149	186	N/A	INTRINSIC
Blast:HECTc	338	459	1e-12	BLAST
HECTc	519	762	7.07e-79	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207816

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with maternally inherited targeted null mutations exhibit reduced brain weight, impaired motor function, inducible seizures, learning deficits, abnormal hippocampal electroencephalographic recordings, and severely impaired long-term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	C	14: 8,243,803	T518A	probably benign	Het
Acvr1b	T	A	15: 101,198,964	V254D	probably damaging	Het
Adar	T	C	3: 89,735,319	I169T	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Arap1	A	T	7: 101,384,912	Q187L	possibly damaging	Het
Atad5	T	A	11: 80,111,493	M1037K	probably damaging	Het
Bsg	T	A	10: 79,708,795	W56R	probably damaging	Het
C1qtnf3	A	G	15: 10,978,541	T276A	probably damaging	Het
Capn2	A	G	1: 182,470,706	C665R	probably damaging	Het
Cast	A	G	13: 74,720,937	S248P	possibly damaging	Het
Cd68	C	T	11: 69,665,658	V108I	probably benign	Het
Cyp2d11	A	T	15: 82,392,078	W131R	probably damaging	Het
Dhx58	A	G	11: 100,703,920	V50A	probably damaging	Het
Fam124a	A	G	14: 62,606,389	S449G	probably benign	Het
Flnc	G	A	6: 29,441,161	M371I	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr149	A	G	3: 62,530,805	S644P	probably damaging	Het
Gucy1b1	G	A	3: 82,044,151	T274I	possibly damaging	Het
Kcnq5	A	G	1: 21,405,856	V541A	probably damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Lig4	G	T	8: 9,972,644	R379S	probably benign	Het
Map7	G	A	10: 20,273,321	R514Q	unknown	Het
Mertk	T	A	2: 128,771,464	F467I	possibly damaging	Het
Mettl4	A	T	17: 94,727,277	Y463*	probably null	Het
Nme8	T	C	13: 19,694,379	D70G	probably damaging	Het
Npat	A	G	9: 53,570,474	N1161D	probably damaging	Het
Olfr1283	T	A	2: 111,368,940	C103S	probably benign	Het
Olfr616	T	A	7: 103,564,506	I258F	probably damaging	Het
Olfr813	T	C	10: 129,856,710	F64S	probably damaging	Het
Paxip1	A	T	5: 27,772,004		probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Plxnc1	T	C	10: 94,843,752	T923A	probably benign	Het
Pms1	T	A	1: 53,192,120	K857*	probably null	Het
Ppp1r9b	A	G	11: 95,002,110	E260G	probably damaging	Het
Prpf3	A	T	3: 95,853,579	S4T	probably benign	Het
Rdh14	T	A	12: 10,394,869	V240D	probably damaging	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
S100a1	A	T	3: 90,512,135	M1K	probably null	Het
Slc2a5	G	A	4: 150,139,823		probably null	Het
Slc5a5	T	C	8: 70,891,179	T160A	probably damaging	Het
Srcap	T	G	7: 127,553,296		probably null	Het
Tcrg-V5	A	C	13: 19,192,558	E42D	possibly damaging	Het
Tgm6	T	A	2: 130,141,908	M329K	possibly damaging	Het
Tom1l1	G	A	11: 90,661,774	A201V	probably benign	Het
Ttc13	T	C	8: 124,675,263	T662A	possibly damaging	Het
Ttn	T	C	2: 76,725,255	T30469A	probably damaging	Het
Vgll2	A	G	10: 52,025,166	E64G	probably damaging	Het
Vmn1r25	A	T	6: 57,979,075	C76*	probably null	Het
Vmn2r101	A	G	17: 19,588,842	N78D	probably damaging	Het
Zcchc10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	11: 53,332,517		probably benign	Het
Zcchc7	C	A	4: 44,926,048	A28E	probably damaging	Het

Other mutations in Ube3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Ube3a	APN	7	59272110	missense	probably damaging	1.00
IGL00886:Ube3a	APN	7	59284737	missense	probably damaging	1.00
IGL02037:Ube3a	APN	7	59275758	unclassified	probably benign
IGL02127:Ube3a	APN	7	59276041	missense	probably benign	0.03
IGL02228:Ube3a	APN	7	59288396	splice site	probably benign
IGL02533:Ube3a	APN	7	59304832	missense	probably damaging	1.00
IGL02706:Ube3a	APN	7	59272133	missense	possibly damaging	0.67
IGL03037:Ube3a	APN	7	59247223	splice site	probably benign
IGL03213:Ube3a	APN	7	59286122	nonsense	probably null
IGL03306:Ube3a	APN	7	59286147	missense	probably damaging	1.00
Kebab	UTSW	7	59288488	missense	probably damaging	1.00
Shawarma	UTSW	7	59276183	nonsense	probably null
PIT4362001:Ube3a	UTSW	7	59276122	missense	possibly damaging	0.86
R0847:Ube3a	UTSW	7	59276586	missense	possibly damaging	0.80
R1765:Ube3a	UTSW	7	59286114	missense	probably damaging	1.00
R1771:Ube3a	UTSW	7	59275966	missense	probably damaging	1.00
R1926:Ube3a	UTSW	7	59276379	missense	probably damaging	1.00
R1992:Ube3a	UTSW	7	59303787	missense	probably damaging	1.00
R2026:Ube3a	UTSW	7	59303726	missense	probably damaging	1.00
R2104:Ube3a	UTSW	7	59276477	missense	possibly damaging	0.95
R3176:Ube3a	UTSW	7	59276519	nonsense	probably null
R3276:Ube3a	UTSW	7	59276519	nonsense	probably null
R3623:Ube3a	UTSW	7	59272112	missense	probably damaging	1.00
R3624:Ube3a	UTSW	7	59272112	missense	probably damaging	1.00
R3690:Ube3a	UTSW	7	59276799	missense	probably damaging	1.00
R4423:Ube3a	UTSW	7	59276113	missense	probably benign	0.10
R4583:Ube3a	UTSW	7	59286063	missense	probably damaging	1.00
R4883:Ube3a	UTSW	7	59243450	start codon destroyed	probably benign	0.21
R4992:Ube3a	UTSW	7	59284820	missense	possibly damaging	0.47
R5175:Ube3a	UTSW	7	59288717	missense	probably damaging	1.00
R5545:Ube3a	UTSW	7	59272024	missense	probably damaging	1.00
R5572:Ube3a	UTSW	7	59288777	missense	probably damaging	1.00
R5635:Ube3a	UTSW	7	59288488	missense	probably damaging	1.00
R5766:Ube3a	UTSW	7	59276059	missense	possibly damaging	0.89
R5890:Ube3a	UTSW	7	59272028	missense	probably damaging	1.00
R5956:Ube3a	UTSW	7	59277020	unclassified	probably benign
R6388:Ube3a	UTSW	7	59304921	splice site	probably null
R6464:Ube3a	UTSW	7	59276183	nonsense	probably null
R6467:Ube3a	UTSW	7	59276902	missense	probably damaging	1.00
R6474:Ube3a	UTSW	7	59287024	missense	probably damaging	1.00
R6669:Ube3a	UTSW	7	59276857	missense	probably benign	0.02
R7003:Ube3a	UTSW	7	59276440	missense	probably damaging	1.00
R7044:Ube3a	UTSW	7	59288413	missense	probably damaging	1.00
R7187:Ube3a	UTSW	7	59275905	missense	probably benign	0.02
R7360:Ube3a	UTSW	7	59276635	missense	probably damaging	1.00
R7363:Ube3a	UTSW	7	59287003	missense	probably benign	0.00
R7508:Ube3a	UTSW	7	59303689	missense	possibly damaging	0.84
R7652:Ube3a	UTSW	7	59243354	start gained	probably benign
R7768:Ube3a	UTSW	7	59288777	missense	probably damaging	1.00
R8015:Ube3a	UTSW	7	59284756	missense	probably damaging	1.00
R8044:Ube3a	UTSW	7	59276572	missense	possibly damaging	0.51
R8476:Ube3a	UTSW	7	59304827	missense	probably damaging	1.00
R9394:Ube3a	UTSW	7	59272212	nonsense	probably null
R9404:Ube3a	UTSW	7	59287015	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCCATTGCCTGTGACAAC -3'
(R):5'- GGCCCTGTTTCTAGCGTTAC -3'

Sequencing Primer
(F):5'- CATTGCCTGTGACAACCTTTC -3'
(R):5'- GCCCTGTTTCTAGCGTTACATTATAG -3'

Posted On

2016-09-06