Mutagenetix > Incidental Mutation

Incidental Mutation 'R5397:Arap1'

429744

Institutional Source

Beutler Lab

Gene Symbol

Arap1

Ensembl Gene

ENSMUSG00000032812

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1

Synonyms

Centd2, 2410002L19Rik

MMRRC Submission

042968-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5397 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101348067-101412586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101384912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 187 (Q187L)

Ref Sequence

ENSEMBL: ENSMUSP00000102624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000107010] [ENSMUST00000127873] [ENSMUST00000130016] [ENSMUST00000134143] [ENSMUST00000141083] [ENSMUST00000148902]

AlphaFold

Q4LDD4

Predicted Effect

probably benign
Transcript: ENSMUST00000084895

SMART Domains

Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
PH	82	175	2.62e-17	SMART
PH	195	285	3.6e-6	SMART
ArfGap	289	415	2.4e-22	SMART
PH	498	606	1.23e-13	SMART
PH	616	710	1.08e0	SMART
RhoGAP	722	904	1.35e-63	SMART
Pfam:RA	926	1015	1.5e-10	PFAM
PH	1029	1141	8.58e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084896
AA Change: Q187L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: Q187L

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	6.6e-13	PFAM
PH	1277	1400	8e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107010
AA Change: Q187L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: Q187L

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	1.9e-10	PFAM
PH	1277	1389	8.58e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127873

SMART Domains

Protein: ENSMUSP00000121257
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130016

SMART Domains

Protein: ENSMUSP00000115850
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134143

SMART Domains

Protein: ENSMUSP00000115107
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
SCOP:d1ki1b2	68	111	4e-4	SMART
Blast:PH	82	111	6e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000141083

Predicted Effect

probably benign
Transcript: ENSMUST00000148902

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152082

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213314

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	C	14: 8,243,803	T518A	probably benign	Het
Acvr1b	T	A	15: 101,198,964	V254D	probably damaging	Het
Adar	T	C	3: 89,735,319	I169T	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Atad5	T	A	11: 80,111,493	M1037K	probably damaging	Het
Bsg	T	A	10: 79,708,795	W56R	probably damaging	Het
C1qtnf3	A	G	15: 10,978,541	T276A	probably damaging	Het
Capn2	A	G	1: 182,470,706	C665R	probably damaging	Het
Cast	A	G	13: 74,720,937	S248P	possibly damaging	Het
Cd68	C	T	11: 69,665,658	V108I	probably benign	Het
Cyp2d11	A	T	15: 82,392,078	W131R	probably damaging	Het
Dhx58	A	G	11: 100,703,920	V50A	probably damaging	Het
Fam124a	A	G	14: 62,606,389	S449G	probably benign	Het
Flnc	G	A	6: 29,441,161	M371I	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr149	A	G	3: 62,530,805	S644P	probably damaging	Het
Gucy1b1	G	A	3: 82,044,151	T274I	possibly damaging	Het
Kcnq5	A	G	1: 21,405,856	V541A	probably damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Lig4	G	T	8: 9,972,644	R379S	probably benign	Het
Map7	G	A	10: 20,273,321	R514Q	unknown	Het
Mertk	T	A	2: 128,771,464	F467I	possibly damaging	Het
Mettl4	A	T	17: 94,727,277	Y463*	probably null	Het
Nme8	T	C	13: 19,694,379	D70G	probably damaging	Het
Npat	A	G	9: 53,570,474	N1161D	probably damaging	Het
Olfr1283	T	A	2: 111,368,940	C103S	probably benign	Het
Olfr616	T	A	7: 103,564,506	I258F	probably damaging	Het
Olfr813	T	C	10: 129,856,710	F64S	probably damaging	Het
Paxip1	A	T	5: 27,772,004		probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Plxnc1	T	C	10: 94,843,752	T923A	probably benign	Het
Pms1	T	A	1: 53,192,120	K857*	probably null	Het
Ppp1r9b	A	G	11: 95,002,110	E260G	probably damaging	Het
Prpf3	A	T	3: 95,853,579	S4T	probably benign	Het
Rdh14	T	A	12: 10,394,869	V240D	probably damaging	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
S100a1	A	T	3: 90,512,135	M1K	probably null	Het
Slc2a5	G	A	4: 150,139,823		probably null	Het
Slc5a5	T	C	8: 70,891,179	T160A	probably damaging	Het
Srcap	T	G	7: 127,553,296		probably null	Het
Tcrg-V5	A	C	13: 19,192,558	E42D	possibly damaging	Het
Tgm6	T	A	2: 130,141,908	M329K	possibly damaging	Het
Tom1l1	G	A	11: 90,661,774	A201V	probably benign	Het
Ttc13	T	C	8: 124,675,263	T662A	possibly damaging	Het
Ttn	T	C	2: 76,725,255	T30469A	probably damaging	Het
Ube3a	T	A	7: 59,286,912	S645R	probably benign	Het
Vgll2	A	G	10: 52,025,166	E64G	probably damaging	Het
Vmn1r25	A	T	6: 57,979,075	C76*	probably null	Het
Vmn2r101	A	G	17: 19,588,842	N78D	probably damaging	Het
Zcchc10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	11: 53,332,517		probably benign	Het
Zcchc7	C	A	4: 44,926,048	A28E	probably damaging	Het

Other mutations in Arap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Arap1	APN	7	101388049	missense	probably damaging	0.96
IGL01311:Arap1	APN	7	101388136	nonsense	probably null
IGL01349:Arap1	APN	7	101387152	missense	possibly damaging	0.84
IGL01521:Arap1	APN	7	101400605	critical splice donor site	probably null
IGL01869:Arap1	APN	7	101400283	missense	probably damaging	1.00
IGL02156:Arap1	APN	7	101388730	unclassified	probably benign
IGL02320:Arap1	APN	7	101385029	missense	probably benign
IGL02478:Arap1	APN	7	101400125	splice site	probably null
R0133:Arap1	UTSW	7	101386229	missense	probably damaging	0.98
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0412:Arap1	UTSW	7	101390222	missense	probably damaging	0.98
R0616:Arap1	UTSW	7	101401650	missense	possibly damaging	0.64
R0838:Arap1	UTSW	7	101400412	missense	probably damaging	1.00
R0962:Arap1	UTSW	7	101384914	missense	possibly damaging	0.56
R1186:Arap1	UTSW	7	101404269	splice site	probably benign
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1724:Arap1	UTSW	7	101400526	missense	possibly damaging	0.91
R1793:Arap1	UTSW	7	101388622	missense	probably benign
R1959:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R1960:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R2020:Arap1	UTSW	7	101401518	missense	probably benign	0.00
R2128:Arap1	UTSW	7	101409320	missense	probably damaging	1.00
R3737:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R3851:Arap1	UTSW	7	101390165	nonsense	probably null
R4034:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R4386:Arap1	UTSW	7	101385571	missense	probably benign
R4435:Arap1	UTSW	7	101390254	missense	possibly damaging	0.74
R4779:Arap1	UTSW	7	101404367	missense	probably damaging	1.00
R4786:Arap1	UTSW	7	101385005	missense	possibly damaging	0.94
R4850:Arap1	UTSW	7	101398791	missense	probably damaging	1.00
R4942:Arap1	UTSW	7	101401802	missense	possibly damaging	0.95
R5253:Arap1	UTSW	7	101388644	missense	probably benign	0.00
R5342:Arap1	UTSW	7	101404960	missense	probably benign	0.00
R5367:Arap1	UTSW	7	101409130	missense	probably damaging	0.99
R5968:Arap1	UTSW	7	101394738	missense	probably damaging	1.00
R6052:Arap1	UTSW	7	101404033	missense	probably damaging	1.00
R6574:Arap1	UTSW	7	101404001	missense	probably damaging	1.00
R6645:Arap1	UTSW	7	101408111	missense	possibly damaging	0.57
R7060:Arap1	UTSW	7	101409357	splice site	probably null
R7191:Arap1	UTSW	7	101384992	missense	probably benign	0.31
R7323:Arap1	UTSW	7	101400211	missense	probably damaging	1.00
R7349:Arap1	UTSW	7	101390228	missense	possibly damaging	0.95
R7516:Arap1	UTSW	7	101409331	missense	probably benign	0.00
R7922:Arap1	UTSW	7	101404414	nonsense	probably null
R8034:Arap1	UTSW	7	101394773	missense	probably damaging	1.00
R8293:Arap1	UTSW	7	101400934	missense	probably benign
R8493:Arap1	UTSW	7	101386518	nonsense	probably null
R8810:Arap1	UTSW	7	101404378	missense	probably damaging	0.99
R8811:Arap1	UTSW	7	101387196	missense	probably damaging	1.00
R8928:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8930:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8931:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8941:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R9014:Arap1	UTSW	7	101404333	missense	probably damaging	1.00
R9144:Arap1	UTSW	7	101398395	missense	probably damaging	1.00
R9164:Arap1	UTSW	7	101391883	nonsense	probably null
R9215:Arap1	UTSW	7	101400007	missense	probably benign	0.23
R9340:Arap1	UTSW	7	101388175	missense	probably damaging	1.00
R9519:Arap1	UTSW	7	101394739	start gained	probably benign
R9790:Arap1	UTSW	7	101388169	missense	probably benign	0.00
R9791:Arap1	UTSW	7	101388169	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGACCAGCACATACATATGGG -3'
(R):5'- TCCATGGCTGATCTCAGGAG -3'

Sequencing Primer
(F):5'- TACATATGGGCCCAAGAGGTGC -3'
(R):5'- ATGGCTGATCTCAGGAGACCAC -3'

Posted On

2016-09-06