Incidental Mutation 'R5397:Olfr616'
ID429745
Institutional Source Beutler Lab
Gene Symbol Olfr616
Ensembl Gene ENSMUSG00000047544
Gene Nameolfactory receptor 616
SynonymsMOR19-1, GA_x6K02T2PBJ9-6289676-6288723
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103563747-103569143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103564506 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 258 (I258F)
Ref Sequence ENSEMBL: ENSMUSP00000150954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
Predicted Effect probably benign
Transcript: ENSMUST00000098198
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106886
AA Change: I258F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544
AA Change: I258F

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214345
Predicted Effect probably damaging
Transcript: ENSMUST00000214806
AA Change: I258F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000215673
Predicted Effect probably damaging
Transcript: ENSMUST00000217293
AA Change: I258F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Olfr616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Olfr616 APN 7 103565021 missense probably damaging 0.99
IGL02366:Olfr616 APN 7 103564415 missense probably damaging 1.00
IGL03028:Olfr616 APN 7 103564589 unclassified probably null
R0087:Olfr616 UTSW 7 103564362 missense probably benign 0.00
R1450:Olfr616 UTSW 7 103564451 missense probably benign 0.12
R1900:Olfr616 UTSW 7 103564607 nonsense probably null
R2026:Olfr616 UTSW 7 103564877 missense probably damaging 1.00
R2139:Olfr616 UTSW 7 103564754 missense possibly damaging 0.90
R2883:Olfr616 UTSW 7 103565264 missense probably benign 0.24
R4359:Olfr616 UTSW 7 103564535 missense probably benign 0.29
R4589:Olfr616 UTSW 7 103564432 missense probably damaging 0.98
R4827:Olfr616 UTSW 7 103564545 missense probably damaging 1.00
R5023:Olfr616 UTSW 7 103565171 missense possibly damaging 0.95
R6109:Olfr616 UTSW 7 103565139 missense probably benign 0.12
R8090:Olfr616 UTSW 7 103564841 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATTTGAGCAAGTTTCCCCAAAC -3'
(R):5'- AGACATCATGAAGCTGGCC -3'

Sequencing Primer
(F):5'- CCCCAAACTTTAAATATTTTGCACAC -3'
(R):5'- CTGTCAGGGTCAACATCATCTATGG -3'
Posted On2016-09-06