Incidental Mutation 'R5397:Ttc13'
ID429748
Institutional Source Beutler Lab
Gene Symbol Ttc13
Ensembl Gene ENSMUSG00000037300
Gene Nametetratricopeptide repeat domain 13
SynonymsMGC:28881
MMRRC Submission 042968-MU
Accession Numbers

Genbank: NM_145607; MGI: 28881

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124671332-124721983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124675263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 662 (T662A)
Ref Sequence ENSEMBL: ENSMUSP00000113383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041614] [ENSMUST00000117624] [ENSMUST00000118134] [ENSMUST00000214828] [ENSMUST00000231984]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041614
AA Change: T586A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038484
Gene: ENSMUSG00000037300
AA Change: T586A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:TPR_11 153 204 3e-8 PFAM
Pfam:TPR_19 154 213 5.1e-8 PFAM
Pfam:TPR_1 173 206 6.1e-10 PFAM
Pfam:TPR_2 173 206 1.2e-7 PFAM
Pfam:TPR_8 173 206 5.2e-8 PFAM
Pfam:TPR_16 177 241 6.5e-11 PFAM
Pfam:TPR_9 179 249 3.5e-6 PFAM
Pfam:TPR_11 204 272 2.2e-8 PFAM
Pfam:TPR_1 207 240 3.3e-5 PFAM
Pfam:TPR_2 207 240 1.9e-5 PFAM
Blast:UTG 692 755 4e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000117624
AA Change: T608A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114043
Gene: ENSMUSG00000037300
AA Change: T608A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 161 2e-13 BLAST
TPR 162 194 1.08e1 SMART
TPR 195 228 2.24e-7 SMART
TPR 229 262 3.67e-3 SMART
Blast:UTG 714 777 4e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000118134
AA Change: T662A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113383
Gene: ENSMUSG00000037300
AA Change: T662A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 156 4e-10 BLAST
TPR 181 214 5.56e-3 SMART
TPR 215 248 1.17e-1 SMART
TPR 249 282 2.24e-7 SMART
TPR 283 316 3.67e-3 SMART
Blast:UTG 768 831 1e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140350
Predicted Effect possibly damaging
Transcript: ENSMUST00000214828
AA Change: T714A

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231984
AA Change: T585A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Ttc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ttc13 APN 8 124688847 splice site probably benign
IGL01086:Ttc13 APN 8 124675346 missense probably damaging 0.98
IGL01411:Ttc13 APN 8 124683285 missense probably damaging 1.00
IGL01511:Ttc13 APN 8 124676371 missense probably damaging 1.00
IGL01610:Ttc13 APN 8 124676344 missense probably damaging 1.00
IGL01626:Ttc13 APN 8 124673738 splice site probably benign
IGL01967:Ttc13 APN 8 124712647 missense probably damaging 0.99
IGL01995:Ttc13 APN 8 124688882 missense probably damaging 1.00
IGL02456:Ttc13 APN 8 124690361 critical splice acceptor site probably null
IGL02816:Ttc13 APN 8 124712676 missense possibly damaging 0.89
3-1:Ttc13 UTSW 8 124679009 missense possibly damaging 0.81
LCD18:Ttc13 UTSW 8 124675866 intron probably benign
R0126:Ttc13 UTSW 8 124683291 missense probably damaging 0.99
R0391:Ttc13 UTSW 8 124674401 missense probably damaging 1.00
R0602:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0629:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0638:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0714:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R1981:Ttc13 UTSW 8 124714187 critical splice donor site probably null
R2051:Ttc13 UTSW 8 124672211 splice site probably null
R2324:Ttc13 UTSW 8 124679057 missense probably damaging 1.00
R2404:Ttc13 UTSW 8 124678997 splice site probably benign
R2571:Ttc13 UTSW 8 124683799 missense probably damaging 1.00
R3110:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R3112:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R4560:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4562:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4563:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4565:Ttc13 UTSW 8 124682087 missense probably damaging 1.00
R4855:Ttc13 UTSW 8 124674435 missense probably damaging 1.00
R4998:Ttc13 UTSW 8 124680056 missense probably damaging 1.00
R5137:Ttc13 UTSW 8 124694935 nonsense probably null
R5619:Ttc13 UTSW 8 124679944 intron probably benign
R5966:Ttc13 UTSW 8 124682220 intron probably benign
R6092:Ttc13 UTSW 8 124679033 missense probably benign 0.36
R6321:Ttc13 UTSW 8 124683191 missense probably damaging 1.00
R6439:Ttc13 UTSW 8 124673482 missense probably benign 0.02
R6737:Ttc13 UTSW 8 124682161 critical splice acceptor site probably null
R6804:Ttc13 UTSW 8 124699687 missense probably damaging 1.00
R6967:Ttc13 UTSW 8 124688618 missense probably benign 0.17
R7542:Ttc13 UTSW 8 124675103 splice site probably null
R7905:Ttc13 UTSW 8 124688596 missense probably benign 0.09
X0027:Ttc13 UTSW 8 124673589 missense probably benign
Z1176:Ttc13 UTSW 8 124694842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCCTCAGTGAAACAGGG -3'
(R):5'- ATGAGCCTCCCACAACTTCTG -3'

Sequencing Primer
(F):5'- GCCTAGCACACTGGAGTTCTTAG -3'
(R):5'- GCAGCCACCATTAGCATTCGTG -3'
Posted On2016-09-06