Mutagenetix > Incidental Mutation

Incidental Mutation 'R5397:Ttc13'

429748

Institutional Source

Beutler Lab

Gene Symbol

Ttc13

Ensembl Gene

ENSMUSG00000037300

Gene Name

tetratricopeptide repeat domain 13

Synonyms

MGC:28881

MMRRC Submission

042968-MU

Accession Numbers

Genbank: NM_145607; MGI: 28881

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5397 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124671332-124721983 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124675263 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 662 (T662A)

Ref Sequence

ENSEMBL: ENSMUSP00000113383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041614] [ENSMUST00000117624] [ENSMUST00000118134] [ENSMUST00000214828] [ENSMUST00000231984]

AlphaFold

A0A1L1SSC7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041614
AA Change: T586A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000038484
Gene: ENSMUSG00000037300
AA Change: T586A

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:TPR_11	153	204	3e-8	PFAM
Pfam:TPR_19	154	213	5.1e-8	PFAM
Pfam:TPR_1	173	206	6.1e-10	PFAM
Pfam:TPR_2	173	206	1.2e-7	PFAM
Pfam:TPR_8	173	206	5.2e-8	PFAM
Pfam:TPR_16	177	241	6.5e-11	PFAM
Pfam:TPR_9	179	249	3.5e-6	PFAM
Pfam:TPR_11	204	272	2.2e-8	PFAM
Pfam:TPR_1	207	240	3.3e-5	PFAM
Pfam:TPR_2	207	240	1.9e-5	PFAM
Blast:UTG	692	755	4e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117624
AA Change: T608A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114043
Gene: ENSMUSG00000037300
AA Change: T608A

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Blast:TPR	128	161	2e-13	BLAST
TPR	162	194	1.08e1	SMART
TPR	195	228	2.24e-7	SMART
TPR	229	262	3.67e-3	SMART
Blast:UTG	714	777	4e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118134
AA Change: T662A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113383
Gene: ENSMUSG00000037300
AA Change: T662A

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Blast:TPR	128	156	4e-10	BLAST
TPR	181	214	5.56e-3	SMART
TPR	215	248	1.17e-1	SMART
TPR	249	282	2.24e-7	SMART
TPR	283	316	3.67e-3	SMART
Blast:UTG	768	831	1e-13	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126674

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128390

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130344

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140350

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214828
AA Change: T714A

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231984
AA Change: T585A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	C	14: 8,243,803	T518A	probably benign	Het
Acvr1b	T	A	15: 101,198,964	V254D	probably damaging	Het
Adar	T	C	3: 89,735,319	I169T	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Arap1	A	T	7: 101,384,912	Q187L	possibly damaging	Het
Atad5	T	A	11: 80,111,493	M1037K	probably damaging	Het
Bsg	T	A	10: 79,708,795	W56R	probably damaging	Het
C1qtnf3	A	G	15: 10,978,541	T276A	probably damaging	Het
Capn2	A	G	1: 182,470,706	C665R	probably damaging	Het
Cast	A	G	13: 74,720,937	S248P	possibly damaging	Het
Cd68	C	T	11: 69,665,658	V108I	probably benign	Het
Cyp2d11	A	T	15: 82,392,078	W131R	probably damaging	Het
Dhx58	A	G	11: 100,703,920	V50A	probably damaging	Het
Fam124a	A	G	14: 62,606,389	S449G	probably benign	Het
Flnc	G	A	6: 29,441,161	M371I	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr149	A	G	3: 62,530,805	S644P	probably damaging	Het
Gucy1b1	G	A	3: 82,044,151	T274I	possibly damaging	Het
Kcnq5	A	G	1: 21,405,856	V541A	probably damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Lig4	G	T	8: 9,972,644	R379S	probably benign	Het
Map7	G	A	10: 20,273,321	R514Q	unknown	Het
Mertk	T	A	2: 128,771,464	F467I	possibly damaging	Het
Mettl4	A	T	17: 94,727,277	Y463*	probably null	Het
Nme8	T	C	13: 19,694,379	D70G	probably damaging	Het
Npat	A	G	9: 53,570,474	N1161D	probably damaging	Het
Olfr1283	T	A	2: 111,368,940	C103S	probably benign	Het
Olfr616	T	A	7: 103,564,506	I258F	probably damaging	Het
Olfr813	T	C	10: 129,856,710	F64S	probably damaging	Het
Paxip1	A	T	5: 27,772,004		probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Plxnc1	T	C	10: 94,843,752	T923A	probably benign	Het
Pms1	T	A	1: 53,192,120	K857*	probably null	Het
Ppp1r9b	A	G	11: 95,002,110	E260G	probably damaging	Het
Prpf3	A	T	3: 95,853,579	S4T	probably benign	Het
Rdh14	T	A	12: 10,394,869	V240D	probably damaging	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
S100a1	A	T	3: 90,512,135	M1K	probably null	Het
Slc2a5	G	A	4: 150,139,823		probably null	Het
Slc5a5	T	C	8: 70,891,179	T160A	probably damaging	Het
Srcap	T	G	7: 127,553,296		probably null	Het
Tcrg-V5	A	C	13: 19,192,558	E42D	possibly damaging	Het
Tgm6	T	A	2: 130,141,908	M329K	possibly damaging	Het
Tom1l1	G	A	11: 90,661,774	A201V	probably benign	Het
Ttn	T	C	2: 76,725,255	T30469A	probably damaging	Het
Ube3a	T	A	7: 59,286,912	S645R	probably benign	Het
Vgll2	A	G	10: 52,025,166	E64G	probably damaging	Het
Vmn1r25	A	T	6: 57,979,075	C76*	probably null	Het
Vmn2r101	A	G	17: 19,588,842	N78D	probably damaging	Het
Zcchc10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	11: 53,332,517		probably benign	Het
Zcchc7	C	A	4: 44,926,048	A28E	probably damaging	Het

Other mutations in Ttc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Ttc13	APN	8	124688847	splice site	probably benign
IGL01086:Ttc13	APN	8	124675346	missense	probably damaging	0.98
IGL01411:Ttc13	APN	8	124683285	missense	probably damaging	1.00
IGL01511:Ttc13	APN	8	124676371	missense	probably damaging	1.00
IGL01610:Ttc13	APN	8	124676344	missense	probably damaging	1.00
IGL01626:Ttc13	APN	8	124673738	splice site	probably benign
IGL01967:Ttc13	APN	8	124712647	missense	probably damaging	0.99
IGL01995:Ttc13	APN	8	124688882	missense	probably damaging	1.00
IGL02456:Ttc13	APN	8	124690361	critical splice acceptor site	probably null
IGL02816:Ttc13	APN	8	124712676	missense	possibly damaging	0.89
3-1:Ttc13	UTSW	8	124679009	missense	possibly damaging	0.81
LCD18:Ttc13	UTSW	8	124675866	intron	probably benign
R0126:Ttc13	UTSW	8	124683291	missense	probably damaging	0.99
R0391:Ttc13	UTSW	8	124674401	missense	probably damaging	1.00
R0602:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R0629:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R0638:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R0714:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R1981:Ttc13	UTSW	8	124714187	critical splice donor site	probably null
R2051:Ttc13	UTSW	8	124672211	splice site	probably null
R2324:Ttc13	UTSW	8	124679057	missense	probably damaging	1.00
R2404:Ttc13	UTSW	8	124678997	splice site	probably benign
R2571:Ttc13	UTSW	8	124683799	missense	probably damaging	1.00
R3110:Ttc13	UTSW	8	124683834	missense	possibly damaging	0.90
R3112:Ttc13	UTSW	8	124683834	missense	possibly damaging	0.90
R4560:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4562:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4563:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4565:Ttc13	UTSW	8	124682087	missense	probably damaging	1.00
R4855:Ttc13	UTSW	8	124674435	missense	probably damaging	1.00
R4998:Ttc13	UTSW	8	124680056	missense	probably damaging	1.00
R5137:Ttc13	UTSW	8	124694935	nonsense	probably null
R5619:Ttc13	UTSW	8	124679944	intron	probably benign
R5966:Ttc13	UTSW	8	124682220	intron	probably benign
R6092:Ttc13	UTSW	8	124679033	missense	probably benign	0.36
R6321:Ttc13	UTSW	8	124683191	missense	probably damaging	1.00
R6439:Ttc13	UTSW	8	124673482	missense	probably benign	0.02
R6737:Ttc13	UTSW	8	124682161	critical splice acceptor site	probably null
R6804:Ttc13	UTSW	8	124699687	missense	probably damaging	1.00
R6967:Ttc13	UTSW	8	124688618	missense	probably benign	0.17
R7542:Ttc13	UTSW	8	124675103	splice site	probably null
R7905:Ttc13	UTSW	8	124688596	missense	probably benign	0.09
R8769:Ttc13	UTSW	8	124679077	missense	possibly damaging	0.71
R8792:Ttc13	UTSW	8	124674360	critical splice donor site	probably null
R8916:Ttc13	UTSW	8	124683237	missense	probably damaging	0.96
R8953:Ttc13	UTSW	8	124675349	missense	probably damaging	1.00
R9149:Ttc13	UTSW	8	124683300	missense	probably benign	0.01
R9151:Ttc13	UTSW	8	124675282	missense	probably benign	0.03
R9221:Ttc13	UTSW	8	124673551	missense	probably benign	0.20
R9251:Ttc13	UTSW	8	124675253	missense	probably benign	0.17
R9502:Ttc13	UTSW	8	124683271	missense	possibly damaging	0.93
R9600:Ttc13	UTSW	8	124688545	missense	probably benign	0.32
X0027:Ttc13	UTSW	8	124673589	missense	probably benign
Z1176:Ttc13	UTSW	8	124694842	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAGCCTCAGTGAAACAGGG -3'
(R):5'- ATGAGCCTCCCACAACTTCTG -3'

Sequencing Primer
(F):5'- GCCTAGCACACTGGAGTTCTTAG -3'
(R):5'- GCAGCCACCATTAGCATTCGTG -3'

Posted On

2016-09-06