Incidental Mutation 'R5397:Npat'
ID429749
Institutional Source Beutler Lab
Gene Symbol Npat
Ensembl Gene ENSMUSG00000033054
Gene Namenuclear protein in the AT region
Synonyms
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53537047-53574342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53570474 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1161 (N1161D)
Ref Sequence ENSEMBL: ENSMUSP00000048709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035850]
Predicted Effect probably damaging
Transcript: ENSMUST00000035850
AA Change: N1161D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: N1161D

DomainStartEndE-ValueType
LisH 3 35 3.09e-3 SMART
low complexity region 585 592 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:NPAT_C 754 1420 4.7e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148336
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Npat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Npat APN 9 53566800 missense possibly damaging 0.82
IGL00503:Npat APN 9 53572649 utr 3 prime probably benign
IGL00694:Npat APN 9 53563517 missense probably benign 0.00
IGL00731:Npat APN 9 53562086 missense probably damaging 0.99
IGL00907:Npat APN 9 53563290 missense possibly damaging 0.64
IGL00949:Npat APN 9 53563362 missense probably benign 0.17
IGL01403:Npat APN 9 53555129 missense probably benign 0.02
IGL01626:Npat APN 9 53556571 missense possibly damaging 0.92
IGL01936:Npat APN 9 53558226 splice site probably benign
IGL02142:Npat APN 9 53569907 missense probably benign
IGL02215:Npat APN 9 53559117 missense probably benign 0.00
IGL02250:Npat APN 9 53548951 nonsense probably null
IGL02624:Npat APN 9 53566810 missense probably damaging 1.00
IGL02928:Npat APN 9 53566838 splice site probably benign
IGL02931:Npat APN 9 53571041 nonsense probably null
IGL03128:Npat APN 9 53550033 splice site probably benign
IGL03238:Npat APN 9 53570426 missense probably damaging 0.98
R0606:Npat UTSW 9 53556481 critical splice donor site probably null
R0688:Npat UTSW 9 53570222 missense probably benign 0.18
R0839:Npat UTSW 9 53545180 missense probably damaging 0.99
R0947:Npat UTSW 9 53570324 missense probably benign 0.08
R1070:Npat UTSW 9 53572592 missense probably damaging 1.00
R1480:Npat UTSW 9 53563066 frame shift probably null
R1599:Npat UTSW 9 53562404 missense possibly damaging 0.62
R1644:Npat UTSW 9 53570172 missense probably damaging 1.00
R1646:Npat UTSW 9 53555134 missense probably benign 0.32
R1699:Npat UTSW 9 53562660 missense probably benign
R1765:Npat UTSW 9 53570222 missense probably benign 0.00
R1793:Npat UTSW 9 53552289 missense probably damaging 1.00
R1866:Npat UTSW 9 53563116 missense probably damaging 1.00
R1898:Npat UTSW 9 53563637 missense probably damaging 1.00
R2018:Npat UTSW 9 53562491 missense probably benign 0.34
R2019:Npat UTSW 9 53562491 missense probably benign 0.34
R2213:Npat UTSW 9 53552381 missense probably benign 0.00
R2432:Npat UTSW 9 53558135 missense probably damaging 1.00
R3816:Npat UTSW 9 53569916 missense probably damaging 0.99
R4764:Npat UTSW 9 53572620 missense probably damaging 1.00
R4889:Npat UTSW 9 53562207 missense probably benign 0.00
R4895:Npat UTSW 9 53570489 missense probably damaging 1.00
R4923:Npat UTSW 9 53571030 missense probably damaging 1.00
R5377:Npat UTSW 9 53550036 critical splice acceptor site probably null
R5504:Npat UTSW 9 53570264 missense probably benign 0.01
R5509:Npat UTSW 9 53570242 missense probably benign 0.00
R5563:Npat UTSW 9 53563127 missense probably damaging 0.97
R5677:Npat UTSW 9 53555100 missense probably benign 0.00
R5868:Npat UTSW 9 53570124 missense probably damaging 0.96
R5927:Npat UTSW 9 53562221 nonsense probably null
R6009:Npat UTSW 9 53563449 missense probably damaging 0.99
R6247:Npat UTSW 9 53545238 missense probably damaging 1.00
R6434:Npat UTSW 9 53563439 missense possibly damaging 0.81
R6784:Npat UTSW 9 53558158 missense probably damaging 1.00
R6799:Npat UTSW 9 53551630 missense probably benign 0.21
R6878:Npat UTSW 9 53556599 missense probably benign
R7027:Npat UTSW 9 53569916 missense possibly damaging 0.90
R7383:Npat UTSW 9 53562778 missense probably benign
R7404:Npat UTSW 9 53554933 splice site probably null
R7408:Npat UTSW 9 53569916 missense probably damaging 0.99
R7444:Npat UTSW 9 53548910 missense probably damaging 0.97
R7755:Npat UTSW 9 53559170 missense possibly damaging 0.92
R7992:Npat UTSW 9 53562867 missense probably benign 0.00
R8108:Npat UTSW 9 53571129 missense probably benign 0.00
R8126:Npat UTSW 9 53552334 missense probably benign
R8213:Npat UTSW 9 53570570 nonsense probably null
R8354:Npat UTSW 9 53566951 missense possibly damaging 0.93
Z1177:Npat UTSW 9 53566828 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGAAGCATCCTTTTCTCATCTTGAC -3'
(R):5'- GTTCCACCTACAGAAGTGGC -3'

Sequencing Primer
(F):5'- ATTCTGTCCTCTACCTTAAAACCAC -3'
(R):5'- CACCTACAGAAGTGGCATTTTTATTG -3'
Posted On2016-09-06