Mutagenetix > Incidental Mutations

Incidental Mutation 'R5397:Npat'

429749

Institutional Source

Beutler Lab

Gene Symbol

Npat

Ensembl Gene

ENSMUSG00000033054

Gene Name

nuclear protein in the AT region

Synonyms

MMRRC Submission

042968-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5397 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53537047-53574342 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53570474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1161 (N1161D)

Ref Sequence

ENSEMBL: ENSMUSP00000048709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035850]

AlphaFold

Q8BMA5

Predicted Effect

probably damaging
Transcript: ENSMUST00000035850
AA Change: N1161D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: N1161D

Domain	Start	End	E-Value	Type
LisH	3	35	3.09e-3	SMART
low complexity region	585	592	N/A	INTRINSIC
low complexity region	697	712	N/A	INTRINSIC
Pfam:NPAT_C	754	1420	4.7e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148336

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	C	14: 8,243,803	T518A	probably benign	Het
Acvr1b	T	A	15: 101,198,964	V254D	probably damaging	Het
Adar	T	C	3: 89,735,319	I169T	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Arap1	A	T	7: 101,384,912	Q187L	possibly damaging	Het
Atad5	T	A	11: 80,111,493	M1037K	probably damaging	Het
Bsg	T	A	10: 79,708,795	W56R	probably damaging	Het
C1qtnf3	A	G	15: 10,978,541	T276A	probably damaging	Het
Capn2	A	G	1: 182,470,706	C665R	probably damaging	Het
Cast	A	G	13: 74,720,937	S248P	possibly damaging	Het
Cd68	C	T	11: 69,665,658	V108I	probably benign	Het
Cyp2d11	A	T	15: 82,392,078	W131R	probably damaging	Het
Dhx58	A	G	11: 100,703,920	V50A	probably damaging	Het
Fam124a	A	G	14: 62,606,389	S449G	probably benign	Het
Flnc	G	A	6: 29,441,161	M371I	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr149	A	G	3: 62,530,805	S644P	probably damaging	Het
Gucy1b1	G	A	3: 82,044,151	T274I	possibly damaging	Het
Kcnq5	A	G	1: 21,405,856	V541A	probably damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Lig4	G	T	8: 9,972,644	R379S	probably benign	Het
Map7	G	A	10: 20,273,321	R514Q	unknown	Het
Mertk	T	A	2: 128,771,464	F467I	possibly damaging	Het
Mettl4	A	T	17: 94,727,277	Y463*	probably null	Het
Nme8	T	C	13: 19,694,379	D70G	probably damaging	Het
Olfr1283	T	A	2: 111,368,940	C103S	probably benign	Het
Olfr616	T	A	7: 103,564,506	I258F	probably damaging	Het
Olfr813	T	C	10: 129,856,710	F64S	probably damaging	Het
Paxip1	A	T	5: 27,772,004		probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Plxnc1	T	C	10: 94,843,752	T923A	probably benign	Het
Pms1	T	A	1: 53,192,120	K857*	probably null	Het
Ppp1r9b	A	G	11: 95,002,110	E260G	probably damaging	Het
Prpf3	A	T	3: 95,853,579	S4T	probably benign	Het
Rdh14	T	A	12: 10,394,869	V240D	probably damaging	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
S100a1	A	T	3: 90,512,135	M1K	probably null	Het
Slc2a5	G	A	4: 150,139,823		probably null	Het
Slc5a5	T	C	8: 70,891,179	T160A	probably damaging	Het
Srcap	T	G	7: 127,553,296		probably null	Het
Tcrg-V5	A	C	13: 19,192,558	E42D	possibly damaging	Het
Tgm6	T	A	2: 130,141,908	M329K	possibly damaging	Het
Tom1l1	G	A	11: 90,661,774	A201V	probably benign	Het
Ttc13	T	C	8: 124,675,263	T662A	possibly damaging	Het
Ttn	T	C	2: 76,725,255	T30469A	probably damaging	Het
Ube3a	T	A	7: 59,286,912	S645R	probably benign	Het
Vgll2	A	G	10: 52,025,166	E64G	probably damaging	Het
Vmn1r25	A	T	6: 57,979,075	C76*	probably null	Het
Vmn2r101	A	G	17: 19,588,842	N78D	probably damaging	Het
Zcchc10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	11: 53,332,517		probably benign	Het
Zcchc7	C	A	4: 44,926,048	A28E	probably damaging	Het

Other mutations in Npat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Npat	APN	9	53566800	missense	possibly damaging	0.82
IGL00503:Npat	APN	9	53572649	utr 3 prime	probably benign
IGL00694:Npat	APN	9	53563517	missense	probably benign	0.00
IGL00731:Npat	APN	9	53562086	missense	probably damaging	0.99
IGL00907:Npat	APN	9	53563290	missense	possibly damaging	0.64
IGL00949:Npat	APN	9	53563362	missense	probably benign	0.17
IGL01403:Npat	APN	9	53555129	missense	probably benign	0.02
IGL01626:Npat	APN	9	53556571	missense	possibly damaging	0.92
IGL01936:Npat	APN	9	53558226	splice site	probably benign
IGL02142:Npat	APN	9	53569907	missense	probably benign
IGL02215:Npat	APN	9	53559117	missense	probably benign	0.00
IGL02250:Npat	APN	9	53548951	nonsense	probably null
IGL02624:Npat	APN	9	53566810	missense	probably damaging	1.00
IGL02928:Npat	APN	9	53566838	splice site	probably benign
IGL02931:Npat	APN	9	53571041	nonsense	probably null
IGL03128:Npat	APN	9	53550033	splice site	probably benign
IGL03238:Npat	APN	9	53570426	missense	probably damaging	0.98
Flotsam	UTSW	9	53570570	nonsense	probably null
kindling	UTSW	9	53563449	missense	probably damaging	0.99
R0606:Npat	UTSW	9	53556481	critical splice donor site	probably null
R0688:Npat	UTSW	9	53570222	missense	probably benign	0.18
R0839:Npat	UTSW	9	53545180	missense	probably damaging	0.99
R0947:Npat	UTSW	9	53570324	missense	probably benign	0.08
R1070:Npat	UTSW	9	53572592	missense	probably damaging	1.00
R1480:Npat	UTSW	9	53563066	frame shift	probably null
R1599:Npat	UTSW	9	53562404	missense	possibly damaging	0.62
R1644:Npat	UTSW	9	53570172	missense	probably damaging	1.00
R1646:Npat	UTSW	9	53555134	missense	probably benign	0.32
R1699:Npat	UTSW	9	53562660	missense	probably benign
R1765:Npat	UTSW	9	53570222	missense	probably benign	0.00
R1793:Npat	UTSW	9	53552289	missense	probably damaging	1.00
R1866:Npat	UTSW	9	53563116	missense	probably damaging	1.00
R1898:Npat	UTSW	9	53563637	missense	probably damaging	1.00
R2018:Npat	UTSW	9	53562491	missense	probably benign	0.34
R2019:Npat	UTSW	9	53562491	missense	probably benign	0.34
R2213:Npat	UTSW	9	53552381	missense	probably benign	0.00
R2432:Npat	UTSW	9	53558135	missense	probably damaging	1.00
R3816:Npat	UTSW	9	53569916	missense	probably damaging	0.99
R4764:Npat	UTSW	9	53572620	missense	probably damaging	1.00
R4889:Npat	UTSW	9	53562207	missense	probably benign	0.00
R4895:Npat	UTSW	9	53570489	missense	probably damaging	1.00
R4923:Npat	UTSW	9	53571030	missense	probably damaging	1.00
R5377:Npat	UTSW	9	53550036	critical splice acceptor site	probably null
R5504:Npat	UTSW	9	53570264	missense	probably benign	0.01
R5509:Npat	UTSW	9	53570242	missense	probably benign	0.00
R5563:Npat	UTSW	9	53563127	missense	probably damaging	0.97
R5677:Npat	UTSW	9	53555100	missense	probably benign	0.00
R5868:Npat	UTSW	9	53570124	missense	probably damaging	0.96
R5927:Npat	UTSW	9	53562221	nonsense	probably null
R6009:Npat	UTSW	9	53563449	missense	probably damaging	0.99
R6247:Npat	UTSW	9	53545238	missense	probably damaging	1.00
R6434:Npat	UTSW	9	53563439	missense	possibly damaging	0.81
R6784:Npat	UTSW	9	53558158	missense	probably damaging	1.00
R6799:Npat	UTSW	9	53551630	missense	probably benign	0.21
R6878:Npat	UTSW	9	53556599	missense	probably benign
R7027:Npat	UTSW	9	53569916	missense	possibly damaging	0.90
R7383:Npat	UTSW	9	53562778	missense	probably benign
R7404:Npat	UTSW	9	53554933	splice site	probably null
R7408:Npat	UTSW	9	53569916	missense	probably damaging	0.99
R7444:Npat	UTSW	9	53548910	missense	probably damaging	0.97
R7755:Npat	UTSW	9	53559170	missense	possibly damaging	0.92
R7992:Npat	UTSW	9	53562867	missense	probably benign	0.00
R8108:Npat	UTSW	9	53571129	missense	probably benign	0.00
R8126:Npat	UTSW	9	53552334	missense	probably benign
R8213:Npat	UTSW	9	53570570	nonsense	probably null
R8354:Npat	UTSW	9	53566951	missense	possibly damaging	0.93
R8429:Npat	UTSW	9	53570609	nonsense	probably null
R8454:Npat	UTSW	9	53566951	missense	possibly damaging	0.93
R8865:Npat	UTSW	9	53570640	missense	probably benign	0.00
R8894:Npat	UTSW	9	53556651	missense	probably damaging	1.00
R9045:Npat	UTSW	9	53563476	missense	possibly damaging	0.83
R9375:Npat	UTSW	9	53563156	missense	possibly damaging	0.69
Z1177:Npat	UTSW	9	53566828	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- GGAAGCATCCTTTTCTCATCTTGAC -3'
(R):5'- GTTCCACCTACAGAAGTGGC -3'

Sequencing Primer
(F):5'- ATTCTGTCCTCTACCTTAAAACCAC -3'
(R):5'- CACCTACAGAAGTGGCATTTTTATTG -3'

Posted On

2016-09-06