Mutagenetix > Incidental Mutation

Incidental Mutation 'R5397:Plxnc1'

429754

Institutional Source

Beutler Lab

Gene Symbol

Plxnc1

Ensembl Gene

ENSMUSG00000074785

Gene Name

plexin C1

Synonyms

CD232, vespr, 2510048K12Rik

MMRRC Submission

042968-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.444) question?

Stock #

R5397 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94790866-94944835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94843752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 923 (T923A)

Ref Sequence

ENSEMBL: ENSMUSP00000096939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099337]

AlphaFold

Q9QZC2

Predicted Effect

probably benign
Transcript: ENSMUST00000099337
AA Change: T923A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: T923A

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Sema	87	431	5.5e-10	PFAM
PSI	454	507	5.28e-12	SMART
PSI	590	634	1.07e-3	SMART
Pfam:TIG	665	752	3.7e-9	PFAM
IPT	755	847	5.14e-7	SMART
IPT	849	954	1.8e-2	SMART
low complexity region	978	997	N/A	INTRINSIC
Pfam:Plexin_cytopl	1018	1541	1.4e-199	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180514

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	C	14: 8,243,803	T518A	probably benign	Het
Acvr1b	T	A	15: 101,198,964	V254D	probably damaging	Het
Adar	T	C	3: 89,735,319	I169T	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Arap1	A	T	7: 101,384,912	Q187L	possibly damaging	Het
Atad5	T	A	11: 80,111,493	M1037K	probably damaging	Het
Bsg	T	A	10: 79,708,795	W56R	probably damaging	Het
C1qtnf3	A	G	15: 10,978,541	T276A	probably damaging	Het
Capn2	A	G	1: 182,470,706	C665R	probably damaging	Het
Cast	A	G	13: 74,720,937	S248P	possibly damaging	Het
Cd68	C	T	11: 69,665,658	V108I	probably benign	Het
Cyp2d11	A	T	15: 82,392,078	W131R	probably damaging	Het
Dhx58	A	G	11: 100,703,920	V50A	probably damaging	Het
Fam124a	A	G	14: 62,606,389	S449G	probably benign	Het
Flnc	G	A	6: 29,441,161	M371I	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr149	A	G	3: 62,530,805	S644P	probably damaging	Het
Gucy1b1	G	A	3: 82,044,151	T274I	possibly damaging	Het
Kcnq5	A	G	1: 21,405,856	V541A	probably damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Lig4	G	T	8: 9,972,644	R379S	probably benign	Het
Map7	G	A	10: 20,273,321	R514Q	unknown	Het
Mertk	T	A	2: 128,771,464	F467I	possibly damaging	Het
Mettl4	A	T	17: 94,727,277	Y463*	probably null	Het
Nme8	T	C	13: 19,694,379	D70G	probably damaging	Het
Npat	A	G	9: 53,570,474	N1161D	probably damaging	Het
Olfr1283	T	A	2: 111,368,940	C103S	probably benign	Het
Olfr616	T	A	7: 103,564,506	I258F	probably damaging	Het
Olfr813	T	C	10: 129,856,710	F64S	probably damaging	Het
Paxip1	A	T	5: 27,772,004		probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Pms1	T	A	1: 53,192,120	K857*	probably null	Het
Ppp1r9b	A	G	11: 95,002,110	E260G	probably damaging	Het
Prpf3	A	T	3: 95,853,579	S4T	probably benign	Het
Rdh14	T	A	12: 10,394,869	V240D	probably damaging	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
S100a1	A	T	3: 90,512,135	M1K	probably null	Het
Slc2a5	G	A	4: 150,139,823		probably null	Het
Slc5a5	T	C	8: 70,891,179	T160A	probably damaging	Het
Srcap	T	G	7: 127,553,296		probably null	Het
Tcrg-V5	A	C	13: 19,192,558	E42D	possibly damaging	Het
Tgm6	T	A	2: 130,141,908	M329K	possibly damaging	Het
Tom1l1	G	A	11: 90,661,774	A201V	probably benign	Het
Ttc13	T	C	8: 124,675,263	T662A	possibly damaging	Het
Ttn	T	C	2: 76,725,255	T30469A	probably damaging	Het
Ube3a	T	A	7: 59,286,912	S645R	probably benign	Het
Vgll2	A	G	10: 52,025,166	E64G	probably damaging	Het
Vmn1r25	A	T	6: 57,979,075	C76*	probably null	Het
Vmn2r101	A	G	17: 19,588,842	N78D	probably damaging	Het
Zcchc10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	11: 53,332,517		probably benign	Het
Zcchc7	C	A	4: 44,926,048	A28E	probably damaging	Het

Other mutations in Plxnc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Plxnc1	APN	10	94847549	missense	probably benign	0.25
IGL01285:Plxnc1	APN	10	94799368	missense	probably damaging	0.99
IGL01867:Plxnc1	APN	10	94798146	missense	possibly damaging	0.61
IGL01994:Plxnc1	APN	10	94849939	missense	probably damaging	1.00
IGL02083:Plxnc1	APN	10	94922725	missense	possibly damaging	0.61
IGL02250:Plxnc1	APN	10	94871031	missense	probably benign	0.00
IGL02429:Plxnc1	APN	10	94882591	missense	probably benign	0.00
IGL02752:Plxnc1	APN	10	94794680	splice site	probably null
IGL02973:Plxnc1	APN	10	94810684	missense	probably damaging	1.00
R0230:Plxnc1	UTSW	10	94799347	missense	probably benign	0.07
R0265:Plxnc1	UTSW	10	94813129	missense	probably benign	0.14
R0271:Plxnc1	UTSW	10	94837918	missense	probably null	1.00
R0299:Plxnc1	UTSW	10	94849821	critical splice donor site	probably null
R0361:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
R0441:Plxnc1	UTSW	10	94796482	missense	probably damaging	1.00
R0558:Plxnc1	UTSW	10	94837935	missense	probably damaging	1.00
R0617:Plxnc1	UTSW	10	94799368	missense	probably damaging	1.00
R0671:Plxnc1	UTSW	10	94799332	missense	possibly damaging	0.63
R0692:Plxnc1	UTSW	10	94837500	critical splice donor site	probably null
R0751:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1184:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1260:Plxnc1	UTSW	10	94831365	missense	probably damaging	0.99
R1680:Plxnc1	UTSW	10	94841551	missense	probably benign	0.14
R1746:Plxnc1	UTSW	10	94844179	splice site	probably null
R1750:Plxnc1	UTSW	10	94799497	missense	probably damaging	1.00
R1751:Plxnc1	UTSW	10	94849815	unclassified	probably benign
R1768:Plxnc1	UTSW	10	94844322	missense	probably benign	0.05
R1876:Plxnc1	UTSW	10	94866941	missense	possibly damaging	0.94
R2004:Plxnc1	UTSW	10	94852622	missense	probably damaging	0.98
R2031:Plxnc1	UTSW	10	94943667	missense	probably benign	0.26
R2184:Plxnc1	UTSW	10	94944269	missense	probably damaging	1.00
R2437:Plxnc1	UTSW	10	94906533	missense	probably benign	0.02
R2927:Plxnc1	UTSW	10	94793292	critical splice acceptor site	probably null
R3001:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3002:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3003:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3441:Plxnc1	UTSW	10	94871010	missense	probably benign	0.00
R3849:Plxnc1	UTSW	10	94794432	missense	probably benign	0.01
R3884:Plxnc1	UTSW	10	94910687	splice site	probably null
R4004:Plxnc1	UTSW	10	94794597	nonsense	probably null
R4679:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
R4730:Plxnc1	UTSW	10	94867468	intron	probably benign
R4937:Plxnc1	UTSW	10	94841473	missense	probably damaging	1.00
R5068:Plxnc1	UTSW	10	94799377	missense	possibly damaging	0.91
R5345:Plxnc1	UTSW	10	94849969	missense	probably benign	0.26
R5416:Plxnc1	UTSW	10	94837554	missense	probably damaging	1.00
R5485:Plxnc1	UTSW	10	94922742	missense	probably benign	0.00
R5543:Plxnc1	UTSW	10	94864774	missense	probably benign
R5826:Plxnc1	UTSW	10	94799473	critical splice donor site	probably null
R6007:Plxnc1	UTSW	10	94793290	missense	possibly damaging	0.88
R6018:Plxnc1	UTSW	10	94943848	missense	probably benign	0.21
R6052:Plxnc1	UTSW	10	94943773	missense	probably benign	0.13
R6291:Plxnc1	UTSW	10	94833642	splice site	probably null
R6653:Plxnc1	UTSW	10	94943876	missense	probably damaging	1.00
R6984:Plxnc1	UTSW	10	94831530	missense	probably damaging	1.00
R7086:Plxnc1	UTSW	10	94831435	missense	probably benign
R7401:Plxnc1	UTSW	10	94871005	missense	probably benign
R7727:Plxnc1	UTSW	10	94944109	missense	probably damaging	1.00
R7789:Plxnc1	UTSW	10	94794477	missense	probably damaging	1.00
R7803:Plxnc1	UTSW	10	94943515	critical splice donor site	probably null
R7809:Plxnc1	UTSW	10	94794440	missense	probably damaging	1.00
R7882:Plxnc1	UTSW	10	94843836	missense	probably benign
R8103:Plxnc1	UTSW	10	94871082	missense	probably benign
R8226:Plxnc1	UTSW	10	94833368	missense	possibly damaging	0.90
R8273:Plxnc1	UTSW	10	94813243	missense	probably benign	0.14
R8299:Plxnc1	UTSW	10	94827179	missense	probably benign	0.35
R8392:Plxnc1	UTSW	10	94801490	missense	possibly damaging	0.75
R8758:Plxnc1	UTSW	10	94922745	missense	possibly damaging	0.91
R8806:Plxnc1	UTSW	10	94799278	missense	probably damaging	1.00
R8882:Plxnc1	UTSW	10	94841566	missense	probably damaging	1.00
R8893:Plxnc1	UTSW	10	94849847	missense	probably benign	0.35
R8956:Plxnc1	UTSW	10	94910586	missense	probably benign	0.00
R9040:Plxnc1	UTSW	10	94943517	nonsense	probably null
R9102:Plxnc1	UTSW	10	94827245	missense	probably damaging	1.00
R9225:Plxnc1	UTSW	10	94793199	missense	probably damaging	1.00
R9324:Plxnc1	UTSW	10	94944823	start gained	probably benign
R9368:Plxnc1	UTSW	10	94864737	nonsense	probably null
R9375:Plxnc1	UTSW	10	94813231	missense	probably benign	0.20
R9430:Plxnc1	UTSW	10	94922682	missense	probably benign	0.01
R9460:Plxnc1	UTSW	10	94865033	missense	probably benign
R9498:Plxnc1	UTSW	10	94813142	missense	possibly damaging	0.48
RF003:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
RF045:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF046:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF047:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
X0024:Plxnc1	UTSW	10	94864715	critical splice donor site	probably null
Z1176:Plxnc1	UTSW	10	94865029	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GCTTGGGCTTGCAGTATCAG -3'
(R):5'- TTATCCCTGGTCTGGAGAGG -3'

Sequencing Primer
(F):5'- GCAGTATCAGCTTTGTCGATC -3'
(R):5'- ATGTGAGTTTCCATGCATGCC -3'

Posted On

2016-09-06