Incidental Mutation 'R5397:Cd68'
ID429758
Institutional Source Beutler Lab
Gene Symbol Cd68
Ensembl Gene ENSMUSG00000018774
Gene NameCD68 antigen
SynonymsLamp4, gp110, Scard1, macrosialin
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69664213-69666153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69665658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 108 (V108I)
Ref Sequence ENSEMBL: ENSMUSP00000104294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018905] [ENSMUST00000018918] [ENSMUST00000102589] [ENSMUST00000108654] [ENSMUST00000155200] [ENSMUST00000148242] [ENSMUST00000163666]
Predicted Effect probably benign
Transcript: ENSMUST00000018905
SMART Domains Protein: ENSMUSP00000018905
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 141 157 N/A INTRINSIC
CTNS 167 198 5.56e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000018918
AA Change: V108I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000018918
Gene: ENSMUSG00000018774
AA Change: V108I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lamp 28 326 5.6e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083928
Predicted Effect probably benign
Transcript: ENSMUST00000102589
Predicted Effect probably benign
Transcript: ENSMUST00000108654
AA Change: V108I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104294
Gene: ENSMUSG00000018774
AA Change: V108I

DomainStartEndE-ValueType
Pfam:Lamp 16 335 3.1e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123995
Predicted Effect probably benign
Transcript: ENSMUST00000125389
SMART Domains Protein: ENSMUSP00000129025
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
CTNS 39 70 1.69e-6 SMART
low complexity region 89 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128519
Predicted Effect probably benign
Transcript: ENSMUST00000129224
SMART Domains Protein: ENSMUSP00000120001
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
CTNS 54 85 1.69e-6 SMART
low complexity region 138 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140186
Predicted Effect probably benign
Transcript: ENSMUST00000155200
SMART Domains Protein: ENSMUSP00000117715
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148242
SMART Domains Protein: ENSMUSP00000133074
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 98 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163666
SMART Domains Protein: ENSMUSP00000127034
Gene: ENSMUSG00000059796

DomainStartEndE-ValueType
DEXDc 51 249 3.61e-60 SMART
HELICc 286 367 1.04e-33 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced antigen presenting activity in dendritic cells in response to ovalbumin stimulation. Mice homozygous for another knock-out allele exhibit increased bone and dysfunctional osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Cd68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cd68 APN 11 69665850 missense probably damaging 1.00
IGL01918:Cd68 APN 11 69665101 missense possibly damaging 0.91
R1474:Cd68 UTSW 11 69664928 unclassified probably benign
R1556:Cd68 UTSW 11 69665850 missense probably damaging 1.00
R5014:Cd68 UTSW 11 69665339 missense probably damaging 1.00
R5656:Cd68 UTSW 11 69664421 missense probably damaging 0.96
R7425:Cd68 UTSW 11 69665112 missense probably benign 0.30
R7442:Cd68 UTSW 11 69665928 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAACGAGCCCAGGACTTG -3'
(R):5'- GCCATCCTTCACGATGACAC -3'

Sequencing Primer
(F):5'- AGCCCAGGACTTGCCTCTTG -3'
(R):5'- TCCTTCACGATGACACCTACAG -3'
Posted On2016-09-06