Incidental Mutation 'R5397:Atad5'
ID429759
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene NameATPase family, AAA domain containing 5
SynonymsLOC237877, C130052G03Rik
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location80089400-80135794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80111493 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1037 (M1037K)
Ref Sequence ENSEMBL: ENSMUSP00000103874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]
Predicted Effect probably damaging
Transcript: ENSMUST00000017694
AA Change: M1037K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: M1037K

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108239
AA Change: M1037K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: M1037K

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154168
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80132858 missense probably benign 0.22
IGL00916:Atad5 APN 11 80119000 missense probably damaging 1.00
IGL01348:Atad5 APN 11 80095564 missense probably benign 0.00
IGL01601:Atad5 APN 11 80095517 missense probably benign 0.45
IGL01916:Atad5 APN 11 80112839 critical splice donor site probably null
IGL02028:Atad5 APN 11 80134110 missense probably benign 0.20
IGL02095:Atad5 APN 11 80094707 missense probably benign 0.24
IGL02142:Atad5 APN 11 80094197 missense probably benign 0.00
IGL02206:Atad5 APN 11 80094183 missense probably damaging 1.00
IGL02385:Atad5 APN 11 80094627 missense probably benign 0.04
IGL02858:Atad5 APN 11 80089775 missense probably damaging 1.00
IGL02962:Atad5 APN 11 80108579 missense possibly damaging 0.86
PIT4362001:Atad5 UTSW 11 80111567 missense probably benign 0.04
R0040:Atad5 UTSW 11 80098014 missense probably benign
R0157:Atad5 UTSW 11 80089817 missense possibly damaging 0.74
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0319:Atad5 UTSW 11 80120790 splice site probably benign
R0401:Atad5 UTSW 11 80120699 missense probably benign 0.11
R0426:Atad5 UTSW 11 80112832 missense probably benign 0.14
R0452:Atad5 UTSW 11 80106421 missense probably damaging 0.98
R0496:Atad5 UTSW 11 80100356 missense probably benign 0.08
R1691:Atad5 UTSW 11 80095532 missense probably benign 0.00
R1812:Atad5 UTSW 11 80133047 missense probably damaging 0.98
R2070:Atad5 UTSW 11 80098052 splice site probably null
R2071:Atad5 UTSW 11 80098052 splice site probably null
R2153:Atad5 UTSW 11 80106377 missense probably benign 0.04
R2415:Atad5 UTSW 11 80094251 missense probably damaging 1.00
R3917:Atad5 UTSW 11 80103294 missense probably null 0.97
R4025:Atad5 UTSW 11 80120686 missense probably damaging 1.00
R4464:Atad5 UTSW 11 80100311 splice site probably null
R4561:Atad5 UTSW 11 80095889 missense probably benign 0.01
R4579:Atad5 UTSW 11 80095191 missense probably damaging 1.00
R4844:Atad5 UTSW 11 80114311 splice site probably null
R4853:Atad5 UTSW 11 80095272 missense probably damaging 1.00
R4873:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R4875:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R5054:Atad5 UTSW 11 80094676 missense probably benign 0.10
R5226:Atad5 UTSW 11 80095062 missense probably damaging 0.99
R5449:Atad5 UTSW 11 80124108 missense probably damaging 1.00
R5571:Atad5 UTSW 11 80111556 missense probably benign 0.05
R5575:Atad5 UTSW 11 80100323 missense probably benign 0.02
R5857:Atad5 UTSW 11 80131329 missense probably benign 0.06
R5927:Atad5 UTSW 11 80127285 missense probably damaging 1.00
R5928:Atad5 UTSW 11 80094177 missense probably damaging 1.00
R5949:Atad5 UTSW 11 80096009 nonsense probably null
R6102:Atad5 UTSW 11 80111572 critical splice donor site probably null
R6254:Atad5 UTSW 11 80127389 missense probably damaging 0.96
R6562:Atad5 UTSW 11 80133206 missense probably benign 0.26
R6744:Atad5 UTSW 11 80134032 missense probably benign 0.00
R7092:Atad5 UTSW 11 80120720 missense possibly damaging 0.68
R7202:Atad5 UTSW 11 80089775 missense probably damaging 1.00
R7345:Atad5 UTSW 11 80096006 missense probably damaging 1.00
R7352:Atad5 UTSW 11 80103343 critical splice donor site probably null
R7358:Atad5 UTSW 11 80133036 missense probably benign 0.32
R7420:Atad5 UTSW 11 80095862 missense probably benign 0.06
R7453:Atad5 UTSW 11 80119143 critical splice donor site probably null
R7990:Atad5 UTSW 11 80133253 nonsense probably null
R8012:Atad5 UTSW 11 80094240 missense probably damaging 1.00
R8152:Atad5 UTSW 11 80095170 missense possibly damaging 0.59
RF003:Atad5 UTSW 11 80111560 missense probably damaging 0.99
X0024:Atad5 UTSW 11 80132783 missense probably benign 0.02
Z1176:Atad5 UTSW 11 80094896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGATTAAAGCTGTGTGATTGG -3'
(R):5'- ACACAGTGAAACCCAGTCTTGAA -3'

Sequencing Primer
(F):5'- ATTAAAGCTGTGTGATTGGTTTTTG -3'
(R):5'- GTGAAACCCAGTCTTGAAAAACC -3'
Posted On2016-09-06