Mutagenetix > Incidental Mutations

Incidental Mutation 'R5397:Atad5'

429759

Institutional Source

Beutler Lab

Gene Symbol

Atad5

Ensembl Gene

ENSMUSG00000017550

Gene Name

ATPase family, AAA domain containing 5

Synonyms

LOC237877, C130052G03Rik

MMRRC Submission

042968-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5397 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80089400-80135794 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80111493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1037 (M1037K)

Ref Sequence

ENSEMBL: ENSMUSP00000103874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]

AlphaFold

Q4QY64

Predicted Effect

probably damaging
Transcript: ENSMUST00000017694
AA Change: M1037K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: M1037K

Domain	Start	End	E-Value	Type
low complexity region	298	311	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	467	486	N/A	INTRINSIC
coiled coil region	665	697	N/A	INTRINSIC
low complexity region	798	807	N/A	INTRINSIC
AAA	1111	1347	5.14e-5	SMART
Blast:AAA	1409	1526	1e-31	BLAST
low complexity region	1573	1583	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108239
AA Change: M1037K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: M1037K

Domain	Start	End	E-Value	Type
low complexity region	298	311	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	467	486	N/A	INTRINSIC
coiled coil region	665	697	N/A	INTRINSIC
low complexity region	798	807	N/A	INTRINSIC
AAA	1108	1344	5.14e-5	SMART
Blast:AAA	1406	1523	1e-31	BLAST
low complexity region	1570	1580	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151815

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154168

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	C	14: 8,243,803	T518A	probably benign	Het
Acvr1b	T	A	15: 101,198,964	V254D	probably damaging	Het
Adar	T	C	3: 89,735,319	I169T	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Arap1	A	T	7: 101,384,912	Q187L	possibly damaging	Het
Bsg	T	A	10: 79,708,795	W56R	probably damaging	Het
C1qtnf3	A	G	15: 10,978,541	T276A	probably damaging	Het
Capn2	A	G	1: 182,470,706	C665R	probably damaging	Het
Cast	A	G	13: 74,720,937	S248P	possibly damaging	Het
Cd68	C	T	11: 69,665,658	V108I	probably benign	Het
Cyp2d11	A	T	15: 82,392,078	W131R	probably damaging	Het
Dhx58	A	G	11: 100,703,920	V50A	probably damaging	Het
Fam124a	A	G	14: 62,606,389	S449G	probably benign	Het
Flnc	G	A	6: 29,441,161	M371I	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr149	A	G	3: 62,530,805	S644P	probably damaging	Het
Gucy1b1	G	A	3: 82,044,151	T274I	possibly damaging	Het
Kcnq5	A	G	1: 21,405,856	V541A	probably damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Lig4	G	T	8: 9,972,644	R379S	probably benign	Het
Map7	G	A	10: 20,273,321	R514Q	unknown	Het
Mertk	T	A	2: 128,771,464	F467I	possibly damaging	Het
Mettl4	A	T	17: 94,727,277	Y463*	probably null	Het
Nme8	T	C	13: 19,694,379	D70G	probably damaging	Het
Npat	A	G	9: 53,570,474	N1161D	probably damaging	Het
Olfr1283	T	A	2: 111,368,940	C103S	probably benign	Het
Olfr616	T	A	7: 103,564,506	I258F	probably damaging	Het
Olfr813	T	C	10: 129,856,710	F64S	probably damaging	Het
Paxip1	A	T	5: 27,772,004		probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Plxnc1	T	C	10: 94,843,752	T923A	probably benign	Het
Pms1	T	A	1: 53,192,120	K857*	probably null	Het
Ppp1r9b	A	G	11: 95,002,110	E260G	probably damaging	Het
Prpf3	A	T	3: 95,853,579	S4T	probably benign	Het
Rdh14	T	A	12: 10,394,869	V240D	probably damaging	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
S100a1	A	T	3: 90,512,135	M1K	probably null	Het
Slc2a5	G	A	4: 150,139,823		probably null	Het
Slc5a5	T	C	8: 70,891,179	T160A	probably damaging	Het
Srcap	T	G	7: 127,553,296		probably null	Het
Tcrg-V5	A	C	13: 19,192,558	E42D	possibly damaging	Het
Tgm6	T	A	2: 130,141,908	M329K	possibly damaging	Het
Tom1l1	G	A	11: 90,661,774	A201V	probably benign	Het
Ttc13	T	C	8: 124,675,263	T662A	possibly damaging	Het
Ttn	T	C	2: 76,725,255	T30469A	probably damaging	Het
Ube3a	T	A	7: 59,286,912	S645R	probably benign	Het
Vgll2	A	G	10: 52,025,166	E64G	probably damaging	Het
Vmn1r25	A	T	6: 57,979,075	C76*	probably null	Het
Vmn2r101	A	G	17: 19,588,842	N78D	probably damaging	Het
Zcchc10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	11: 53,332,517		probably benign	Het
Zcchc7	C	A	4: 44,926,048	A28E	probably damaging	Het

Other mutations in Atad5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Atad5	APN	11	80132858	missense	probably benign	0.22
IGL00916:Atad5	APN	11	80119000	missense	probably damaging	1.00
IGL01348:Atad5	APN	11	80095564	missense	probably benign	0.00
IGL01601:Atad5	APN	11	80095517	missense	probably benign	0.45
IGL01916:Atad5	APN	11	80112839	critical splice donor site	probably null
IGL02028:Atad5	APN	11	80134110	missense	probably benign	0.20
IGL02095:Atad5	APN	11	80094707	missense	probably benign	0.24
IGL02142:Atad5	APN	11	80094197	missense	probably benign	0.00
IGL02206:Atad5	APN	11	80094183	missense	probably damaging	1.00
IGL02385:Atad5	APN	11	80094627	missense	probably benign	0.04
IGL02858:Atad5	APN	11	80089775	missense	probably damaging	1.00
IGL02962:Atad5	APN	11	80108579	missense	possibly damaging	0.86
PIT4362001:Atad5	UTSW	11	80111567	missense	probably benign	0.04
R0040:Atad5	UTSW	11	80098014	missense	probably benign
R0157:Atad5	UTSW	11	80089817	missense	possibly damaging	0.74
R0211:Atad5	UTSW	11	80095647	missense	probably benign	0.00
R0211:Atad5	UTSW	11	80095647	missense	probably benign	0.00
R0319:Atad5	UTSW	11	80120790	splice site	probably benign
R0401:Atad5	UTSW	11	80120699	missense	probably benign	0.11
R0426:Atad5	UTSW	11	80112832	missense	probably benign	0.14
R0452:Atad5	UTSW	11	80106421	missense	probably damaging	0.98
R0496:Atad5	UTSW	11	80100356	missense	probably benign	0.08
R1691:Atad5	UTSW	11	80095532	missense	probably benign	0.00
R1812:Atad5	UTSW	11	80133047	missense	probably damaging	0.98
R2070:Atad5	UTSW	11	80098052	splice site	probably null
R2071:Atad5	UTSW	11	80098052	splice site	probably null
R2153:Atad5	UTSW	11	80106377	missense	probably benign	0.04
R2415:Atad5	UTSW	11	80094251	missense	probably damaging	1.00
R3917:Atad5	UTSW	11	80103294	missense	probably null	0.97
R4025:Atad5	UTSW	11	80120686	missense	probably damaging	1.00
R4464:Atad5	UTSW	11	80100311	splice site	probably null
R4561:Atad5	UTSW	11	80095889	missense	probably benign	0.01
R4579:Atad5	UTSW	11	80095191	missense	probably damaging	1.00
R4844:Atad5	UTSW	11	80114311	splice site	probably null
R4853:Atad5	UTSW	11	80095272	missense	probably damaging	1.00
R4873:Atad5	UTSW	11	80120689	missense	probably damaging	1.00
R4875:Atad5	UTSW	11	80120689	missense	probably damaging	1.00
R5054:Atad5	UTSW	11	80094676	missense	probably benign	0.10
R5226:Atad5	UTSW	11	80095062	missense	probably damaging	0.99
R5449:Atad5	UTSW	11	80124108	missense	probably damaging	1.00
R5571:Atad5	UTSW	11	80111556	missense	probably benign	0.05
R5575:Atad5	UTSW	11	80100323	missense	probably benign	0.02
R5857:Atad5	UTSW	11	80131329	missense	probably benign	0.06
R5927:Atad5	UTSW	11	80127285	missense	probably damaging	1.00
R5928:Atad5	UTSW	11	80094177	missense	probably damaging	1.00
R5949:Atad5	UTSW	11	80096009	nonsense	probably null
R6102:Atad5	UTSW	11	80111572	critical splice donor site	probably null
R6254:Atad5	UTSW	11	80127389	missense	probably damaging	0.96
R6562:Atad5	UTSW	11	80133206	missense	probably benign	0.26
R6744:Atad5	UTSW	11	80134032	missense	probably benign	0.00
R7092:Atad5	UTSW	11	80120720	missense	possibly damaging	0.68
R7202:Atad5	UTSW	11	80089775	missense	probably damaging	1.00
R7345:Atad5	UTSW	11	80096006	missense	probably damaging	1.00
R7352:Atad5	UTSW	11	80103343	critical splice donor site	probably null
R7358:Atad5	UTSW	11	80133036	missense	probably benign	0.32
R7420:Atad5	UTSW	11	80095862	missense	probably benign	0.06
R7453:Atad5	UTSW	11	80119143	critical splice donor site	probably null
R7990:Atad5	UTSW	11	80133253	nonsense	probably null
R8012:Atad5	UTSW	11	80094240	missense	probably damaging	1.00
R8152:Atad5	UTSW	11	80095170	missense	possibly damaging	0.59
R8421:Atad5	UTSW	11	80094558	missense	probably damaging	0.98
R8842:Atad5	UTSW	11	80110084	missense	possibly damaging	0.87
R8918:Atad5	UTSW	11	80095647	missense	probably benign	0.02
R8943:Atad5	UTSW	11	80095698	missense	possibly damaging	0.86
R8944:Atad5	UTSW	11	80095698	missense	possibly damaging	0.86
R9134:Atad5	UTSW	11	80133105	missense	probably benign	0.00
R9137:Atad5	UTSW	11	80095655	missense	probably damaging	1.00
R9301:Atad5	UTSW	11	80096019	missense	probably damaging	1.00
R9372:Atad5	UTSW	11	80094268	missense	possibly damaging	0.68
R9404:Atad5	UTSW	11	80114238	missense	probably damaging	1.00
RF003:Atad5	UTSW	11	80111560	missense	probably damaging	0.99
X0024:Atad5	UTSW	11	80132783	missense	probably benign	0.02
Z1176:Atad5	UTSW	11	80094896	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGAGATTAAAGCTGTGTGATTGG -3'
(R):5'- ACACAGTGAAACCCAGTCTTGAA -3'

Sequencing Primer
(F):5'- ATTAAAGCTGTGTGATTGGTTTTTG -3'
(R):5'- GTGAAACCCAGTCTTGAAAAACC -3'

Posted On

2016-09-06