Incidental Mutation 'R5397:C1qtnf3'
ID429770
Institutional Source Beutler Lab
Gene Symbol C1qtnf3
Ensembl Gene ENSMUSG00000058914
Gene NameC1q and tumor necrosis factor related protein 3
SynonymsCorcs, CTRP3, 2310005P21Rik, CORS-26
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10952332-10980150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10978541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 276 (T276A)
Ref Sequence ENSEMBL: ENSMUSP00000106152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022853] [ENSMUST00000070877] [ENSMUST00000110523]
Predicted Effect probably benign
Transcript: ENSMUST00000022853
AA Change: T203A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022853
Gene: ENSMUSG00000058914
AA Change: T203A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
C1Q 111 245 2.26e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070877
SMART Domains Protein: ENSMUSP00000066915
Gene: ENSMUSG00000022244

DomainStartEndE-ValueType
Pfam:CoA_transf_3 3 349 1.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110523
AA Change: T276A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106152
Gene: ENSMUSG00000058914
AA Change: T276A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
C1Q 184 318 2.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228886
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in C1qtnf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:C1qtnf3 APN 15 10960682 missense probably damaging 1.00
IGL02491:C1qtnf3 APN 15 10971981 missense possibly damaging 0.69
mimosa_pudica UTSW 15 10958070 critical splice donor site probably null
R0083:C1qtnf3 UTSW 15 10975632 missense possibly damaging 0.89
R1136:C1qtnf3 UTSW 15 10978584 missense probably damaging 0.98
R1447:C1qtnf3 UTSW 15 10952649 missense probably damaging 1.00
R1510:C1qtnf3 UTSW 15 10975636 missense probably benign 0.05
R4536:C1qtnf3 UTSW 15 10972027 missense probably damaging 0.98
R5833:C1qtnf3 UTSW 15 10975630 missense probably benign 0.06
R6483:C1qtnf3 UTSW 15 10958070 critical splice donor site probably null
R6555:C1qtnf3 UTSW 15 10975656 missense probably damaging 0.99
R7324:C1qtnf3 UTSW 15 10952621 missense probably benign 0.04
R7456:C1qtnf3 UTSW 15 10972051 missense probably benign 0.02
R7772:C1qtnf3 UTSW 15 10958044 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GTTGATCATCTAGAGGCAAGGG -3'
(R):5'- AGCTCAGCTATAAATTGCCCC -3'

Sequencing Primer
(F):5'- AGGAGGTAGGTTTTAATAGACAGTTC -3'
(R):5'- CCAAAGTGGAGATATCCTGTCTTC -3'
Posted On2016-09-06