Incidental Mutation 'R5397:Acvr1b'
ID429772
Institutional Source Beutler Lab
Gene Symbol Acvr1b
Ensembl Gene ENSMUSG00000000532
Gene Nameactivin A receptor, type 1B
SynonymsActR-IB, ActRIB, Alk4, SKR2, Acvrlk4
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101174067-101213684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101198964 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 254 (V254D)
Ref Sequence ENSEMBL: ENSMUSP00000000544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000544]
Predicted Effect probably damaging
Transcript: ENSMUST00000000544
AA Change: V254D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000544
Gene: ENSMUSG00000000532
AA Change: V254D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 32 108 4.1e-13 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 177 207 1.89e-14 SMART
Blast:STYKc 209 494 2e-26 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
PHENOTYPE: Embryos homozygous for targeted mutations that inactivate the gene arrest at the egg cylinder stage, prior to gastrulation, showing epiblast and extraembryonic ectoderm disorganization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Acvr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03010:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03011:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03013:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03051:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03127:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03166:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03265:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL02980:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
IGL02984:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
R1367:Acvr1b UTSW 15 101193938 missense possibly damaging 0.58
R1498:Acvr1b UTSW 15 101194010 missense probably benign
R1591:Acvr1b UTSW 15 101194024 missense probably benign
R1757:Acvr1b UTSW 15 101198822 missense possibly damaging 0.47
R1793:Acvr1b UTSW 15 101194025 missense probably benign 0.01
R2223:Acvr1b UTSW 15 101203043 missense probably benign 0.10
R2249:Acvr1b UTSW 15 101203094 missense probably null 1.00
R4674:Acvr1b UTSW 15 101203058 missense possibly damaging 0.94
R4676:Acvr1b UTSW 15 101202986 missense probably damaging 1.00
R5151:Acvr1b UTSW 15 101210770 missense probably damaging 1.00
R5223:Acvr1b UTSW 15 101193976 missense probably damaging 1.00
R5574:Acvr1b UTSW 15 101202077 missense probably benign 0.03
R5906:Acvr1b UTSW 15 101193891 intron probably benign
R6025:Acvr1b UTSW 15 101194975 missense probably benign 0.43
R6467:Acvr1b UTSW 15 101194841 missense possibly damaging 0.86
R7158:Acvr1b UTSW 15 101194058 missense probably benign
X0067:Acvr1b UTSW 15 101194022 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTTGGCCTACAGGGTTACCC -3'
(R):5'- AATAACCCAGGTTCCGTGTGAG -3'

Sequencing Primer
(F):5'- CCTTTTTGTCCAGCGCACAG -3'
(R):5'- CGTGTGAGCATCTTGGCATAAAATG -3'
Posted On2016-09-06