Mutagenetix > Incidental Mutation

Incidental Mutation 'R5397:Afg3l2'

429775

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

042968-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5397 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 67421259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 458 (L458M)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Meta Mutation Damage Score

0.3865

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	C	14: 8,243,803	T518A	probably benign	Het
Acvr1b	T	A	15: 101,198,964	V254D	probably damaging	Het
Adar	T	C	3: 89,735,319	I169T	probably benign	Het
Arap1	A	T	7: 101,384,912	Q187L	possibly damaging	Het
Atad5	T	A	11: 80,111,493	M1037K	probably damaging	Het
Bsg	T	A	10: 79,708,795	W56R	probably damaging	Het
C1qtnf3	A	G	15: 10,978,541	T276A	probably damaging	Het
Capn2	A	G	1: 182,470,706	C665R	probably damaging	Het
Cast	A	G	13: 74,720,937	S248P	possibly damaging	Het
Cd68	C	T	11: 69,665,658	V108I	probably benign	Het
Cyp2d11	A	T	15: 82,392,078	W131R	probably damaging	Het
Dhx58	A	G	11: 100,703,920	V50A	probably damaging	Het
Fam124a	A	G	14: 62,606,389	S449G	probably benign	Het
Flnc	G	A	6: 29,441,161	M371I	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr149	A	G	3: 62,530,805	S644P	probably damaging	Het
Gucy1b1	G	A	3: 82,044,151	T274I	possibly damaging	Het
Kcnq5	A	G	1: 21,405,856	V541A	probably damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Lig4	G	T	8: 9,972,644	R379S	probably benign	Het
Map7	G	A	10: 20,273,321	R514Q	unknown	Het
Mertk	T	A	2: 128,771,464	F467I	possibly damaging	Het
Mettl4	A	T	17: 94,727,277	Y463*	probably null	Het
Nme8	T	C	13: 19,694,379	D70G	probably damaging	Het
Npat	A	G	9: 53,570,474	N1161D	probably damaging	Het
Olfr1283	T	A	2: 111,368,940	C103S	probably benign	Het
Olfr616	T	A	7: 103,564,506	I258F	probably damaging	Het
Olfr813	T	C	10: 129,856,710	F64S	probably damaging	Het
Paxip1	A	T	5: 27,772,004		probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Plxnc1	T	C	10: 94,843,752	T923A	probably benign	Het
Pms1	T	A	1: 53,192,120	K857*	probably null	Het
Ppp1r9b	A	G	11: 95,002,110	E260G	probably damaging	Het
Prpf3	A	T	3: 95,853,579	S4T	probably benign	Het
Rdh14	T	A	12: 10,394,869	V240D	probably damaging	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
S100a1	A	T	3: 90,512,135	M1K	probably null	Het
Slc2a5	G	A	4: 150,139,823		probably null	Het
Slc5a5	T	C	8: 70,891,179	T160A	probably damaging	Het
Srcap	T	G	7: 127,553,296		probably null	Het
Tcrg-V5	A	C	13: 19,192,558	E42D	possibly damaging	Het
Tgm6	T	A	2: 130,141,908	M329K	possibly damaging	Het
Tom1l1	G	A	11: 90,661,774	A201V	probably benign	Het
Ttc13	T	C	8: 124,675,263	T662A	possibly damaging	Het
Ttn	T	C	2: 76,725,255	T30469A	probably damaging	Het
Ube3a	T	A	7: 59,286,912	S645R	probably benign	Het
Vgll2	A	G	10: 52,025,166	E64G	probably damaging	Het
Vmn1r25	A	T	6: 57,979,075	C76*	probably null	Het
Vmn2r101	A	G	17: 19,588,842	N78D	probably damaging	Het
Zcchc10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	11: 53,332,517		probably benign	Het
Zcchc7	C	A	4: 44,926,048	A28E	probably damaging	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'

Posted On

2016-09-06