Incidental Mutation 'R5398:Ptprt'
ID 429786
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase, receptor type, T
Synonyms RPTPrho
MMRRC Submission 042969-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5398 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 161521990-162661147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 161927592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 451 (Y451C)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: Y451C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: Y451C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: Y451C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: Y451C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: Y451C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: Y451C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: Y451C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: Y451C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.6005 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 (GRCm38) L34P possibly damaging Het
Adam34 A C 8: 43,651,241 (GRCm38) C456G probably damaging Het
Anapc15 C T 7: 101,898,603 (GRCm38) P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 (GRCm38) D407G probably damaging Het
Btbd19 G A 4: 117,123,760 (GRCm38) A104V probably damaging Het
Chac1 T G 2: 119,353,244 (GRCm38) L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 (GRCm38) D709G probably benign Het
Ddx42 T A 11: 106,224,898 (GRCm38) D112E probably benign Het
Dnah5 A G 15: 28,293,726 (GRCm38) K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 (GRCm38) Y291* probably null Het
Dsg2 T C 18: 20,579,133 (GRCm38) F109L probably benign Het
Egfl8 T C 17: 34,614,639 (GRCm38) probably benign Het
Emb T A 13: 117,267,552 (GRCm38) I280N probably damaging Het
Gcc2 C A 10: 58,269,507 (GRCm38) N188K probably benign Het
Gdpd4 A T 7: 97,971,978 (GRCm38) H166L probably benign Het
Gm4787 G C 12: 81,377,830 (GRCm38) T518S probably benign Het
Gm8741 G T 17: 35,336,086 (GRCm38) noncoding transcript Het
Itga11 A G 9: 62,745,923 (GRCm38) T360A probably benign Het
Kctd1 A G 18: 15,062,265 (GRCm38) S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 (GRCm38) probably null Het
Kif24 T C 4: 41,394,401 (GRCm38) E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 (GRCm38) noncoding transcript Het
Ociad1 T A 5: 73,310,412 (GRCm38) V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 (GRCm38) probably null Het
Olfr365 C A 2: 37,201,318 (GRCm38) Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 (GRCm38) L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 (GRCm38) V634L probably benign Het
Pcnx2 T C 8: 125,887,948 (GRCm38) K255E possibly damaging Het
Pex5l T A 3: 32,952,490 (GRCm38) I577F probably damaging Het
Ppl A G 16: 5,104,922 (GRCm38) M235T probably benign Het
Prl7d1 T A 13: 27,710,074 (GRCm38) I171F probably damaging Het
Ranbp17 A T 11: 33,474,998 (GRCm38) Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 (GRCm38) T11I probably benign Het
Rragb G A X: 153,140,554 (GRCm38) G24E probably damaging Het
Scn9a T C 2: 66,488,043 (GRCm38) Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 (GRCm38) T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 (GRCm38) I61N probably damaging Het
Sntb1 C G 15: 55,642,795 (GRCm38) G461R probably damaging Het
Sp110 C G 1: 85,589,118 (GRCm38) E219D probably damaging Het
Spink12 A G 18: 44,107,727 (GRCm38) D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 (GRCm38) I289V probably benign Het
Srebf2 A G 15: 82,171,242 (GRCm38) T176A probably damaging Het
Syce1l T C 8: 113,652,513 (GRCm38) L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 (GRCm38) I538T probably benign Het
Tcte1 C T 17: 45,539,826 (GRCm38) Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 (GRCm38) D177A probably damaging Het
Thada T G 17: 84,426,186 (GRCm38) D1011A probably benign Het
Tnn T A 1: 160,147,522 (GRCm38) M112L probably benign Het
Traf1 T C 2: 34,945,435 (GRCm38) E325G probably damaging Het
Tyw1 T C 5: 130,277,157 (GRCm38) probably benign Het
Vmn2r111 C A 17: 22,573,271 (GRCm38) M1I probably null Het
Wdr11 C T 7: 129,631,232 (GRCm38) T996M probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,810,624 (GRCm38) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,560,191 (GRCm38) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,656,163 (GRCm38) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,551,817 (GRCm38) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,268,079 (GRCm38) splice site probably benign
IGL02008:Ptprt APN 2 161,927,673 (GRCm38) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,238,072 (GRCm38) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,555,502 (GRCm38) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,278,046 (GRCm38) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,238,060 (GRCm38) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,530,517 (GRCm38) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,547,381 (GRCm38) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,278,107 (GRCm38) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,766,307 (GRCm38) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,607,452 (GRCm38) splice site probably benign
IGL03379:Ptprt APN 2 161,555,459 (GRCm38) nonsense probably null
Poverina UTSW 2 161,901,497 (GRCm38) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,533,613 (GRCm38) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,927,791 (GRCm38) splice site probably benign
R0129:Ptprt UTSW 2 162,278,070 (GRCm38) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,278,110 (GRCm38) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,278,110 (GRCm38) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,278,110 (GRCm38) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,607,319 (GRCm38) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,553,822 (GRCm38) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,553,825 (GRCm38) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,551,748 (GRCm38) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,812,120 (GRCm38) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,812,139 (GRCm38) splice site probably null
R1023:Ptprt UTSW 2 161,558,943 (GRCm38) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,927,772 (GRCm38) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,278,226 (GRCm38) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,927,484 (GRCm38) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,238,034 (GRCm38) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,810,549 (GRCm38) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,927,640 (GRCm38) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,766,321 (GRCm38) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,558,898 (GRCm38) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,534,545 (GRCm38) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,811,988 (GRCm38) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,278,040 (GRCm38) splice site probably benign
R3432:Ptprt UTSW 2 161,927,529 (GRCm38) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,566,157 (GRCm38) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,812,030 (GRCm38) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,812,030 (GRCm38) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,547,387 (GRCm38) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,547,387 (GRCm38) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,555,555 (GRCm38) splice site probably benign
R4003:Ptprt UTSW 2 161,566,117 (GRCm38) splice site probably benign
R4387:Ptprt UTSW 2 161,927,650 (GRCm38) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,564,689 (GRCm38) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,553,845 (GRCm38) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,901,446 (GRCm38) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,560,239 (GRCm38) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,238,175 (GRCm38) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,927,756 (GRCm38) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,278,164 (GRCm38) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,698,049 (GRCm38) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,278,223 (GRCm38) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,810,604 (GRCm38) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,534,564 (GRCm38) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,560,269 (GRCm38) missense probably damaging 1.00
R5872:Ptprt UTSW 2 162,135,218 (GRCm38) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,564,686 (GRCm38) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,268,029 (GRCm38) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,901,497 (GRCm38) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,553,859 (GRCm38) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,553,783 (GRCm38) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,534,587 (GRCm38) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,530,447 (GRCm38) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,553,840 (GRCm38) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,547,364 (GRCm38) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,533,523 (GRCm38) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,607,305 (GRCm38) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,575,787 (GRCm38) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,575,741 (GRCm38) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,530,493 (GRCm38) missense probably damaging 1.00
R8031:Ptprt UTSW 2 162,135,457 (GRCm38) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,927,661 (GRCm38) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,278,085 (GRCm38) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,687,068 (GRCm38) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,927,646 (GRCm38) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,558,886 (GRCm38) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,551,747 (GRCm38) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,901,531 (GRCm38) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,558,886 (GRCm38) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,558,863 (GRCm38) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,530,543 (GRCm38) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,766,394 (GRCm38) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,530,441 (GRCm38) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,560,186 (GRCm38) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,575,778 (GRCm38) missense probably benign
R9318:Ptprt UTSW 2 161,575,778 (GRCm38) missense probably benign
R9476:Ptprt UTSW 2 161,555,461 (GRCm38) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,555,461 (GRCm38) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,553,812 (GRCm38) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,927,483 (GRCm38) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,238,121 (GRCm38) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,362,948 (GRCm38) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,732,887 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCCTCACTTACCGGCATG -3'
(R):5'- TCCTGCAGTCTCCTCAAAAC -3'

Sequencing Primer
(F):5'- TTACCGGCATGACCCACAGG -3'
(R):5'- TTACAGATCCCGTGCATGG -3'
Posted On 2016-09-06