Incidental Mutation 'R5398:Adam32'
ID429800
Institutional Source Beutler Lab
Gene Symbol Adam32
Ensembl Gene ENSMUSG00000037437
Gene Namea disintegrin and metallopeptidase domain 32
Synonyms
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24836140-24948804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24872579 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 34 (L34P)
Ref Sequence ENSEMBL: ENSMUSP00000133631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119720] [ENSMUST00000121438] [ENSMUST00000173069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119720
AA Change: L610P

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113076
Gene: ENSMUSG00000037437
AA Change: L610P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 145 4.5e-32 PFAM
Pfam:Reprolysin 187 384 4.1e-66 PFAM
Pfam:Reprolysin_3 211 318 6.2e-7 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121438
AA Change: L610P

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113627
Gene: ENSMUSG00000037437
AA Change: L610P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 145 8.4e-26 PFAM
Pfam:Reprolysin 187 384 1.3e-68 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
EGF 631 660 1.73e0 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 719 754 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140573
SMART Domains Protein: ENSMUSP00000133843
Gene: ENSMUSG00000037437

DomainStartEndE-ValueType
Blast:DISIN 2 22 5e-7 BLAST
Pfam:ADAM_CR 24 71 1.3e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173069
AA Change: L34P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133631
Gene: ENSMUSG00000037437
AA Change: L34P

DomainStartEndE-ValueType
Blast:ACR 1 46 7e-25 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an metalloprotease, disintegrin and epidermal growth factor-like domains. This gene was found to be expressed predominantly in the pachytene spermatocytes, where the processed protein is localized to the sperm surface. This gene is located in a cluster of other disintegrin and metallopeptidase family genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I61N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Adam32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Adam32 APN 8 24921354 missense probably damaging 1.00
IGL00793:Adam32 APN 8 24837830 splice site probably benign
IGL01317:Adam32 APN 8 24872581 missense probably damaging 1.00
IGL01475:Adam32 APN 8 24872648 missense probably damaging 1.00
IGL01501:Adam32 APN 8 24914353 missense probably damaging 1.00
IGL01659:Adam32 APN 8 24870774 splice site probably benign
IGL01994:Adam32 APN 8 24902796 splice site probably benign
IGL02137:Adam32 APN 8 24872594 missense probably damaging 1.00
IGL02393:Adam32 APN 8 24920053 missense probably damaging 1.00
IGL02516:Adam32 APN 8 24898596 missense probably damaging 1.00
IGL02892:Adam32 APN 8 24878711 intron probably benign
IGL02929:Adam32 APN 8 24872643 missense possibly damaging 0.81
IGL03273:Adam32 APN 8 24921340 missense probably damaging 1.00
PIT4515001:Adam32 UTSW 8 24914326 missense possibly damaging 0.88
R0088:Adam32 UTSW 8 24914067 missense probably damaging 1.00
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0189:Adam32 UTSW 8 24922337 critical splice acceptor site probably null
R1740:Adam32 UTSW 8 24921298 missense probably damaging 1.00
R1853:Adam32 UTSW 8 24898626 missense probably benign 0.02
R2090:Adam32 UTSW 8 24901440 critical splice donor site probably null
R2906:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R2907:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R4304:Adam32 UTSW 8 24901529 missense probably damaging 1.00
R4612:Adam32 UTSW 8 24872736 missense probably damaging 1.00
R4673:Adam32 UTSW 8 24884455 missense probably damaging 1.00
R4786:Adam32 UTSW 8 24863493 missense probably damaging 1.00
R5292:Adam32 UTSW 8 24864451 missense possibly damaging 0.85
R5524:Adam32 UTSW 8 24922312 missense probably damaging 0.99
R5939:Adam32 UTSW 8 24914122 missense probably damaging 1.00
R6350:Adam32 UTSW 8 24863429 missense possibly damaging 0.86
R6766:Adam32 UTSW 8 24872630 missense probably damaging 0.96
R6893:Adam32 UTSW 8 24878754 missense probably damaging 1.00
R7095:Adam32 UTSW 8 24914070 missense probably damaging 1.00
R7241:Adam32 UTSW 8 24898494 missense probably benign 0.00
R7457:Adam32 UTSW 8 24884619 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGACGTTTAGAATTACATGGTG -3'
(R):5'- GGGAGATTGATTTGTACGTACCC -3'

Sequencing Primer
(F):5'- GATTACATTCCTAAAGCTAGCCG -3'
(R):5'- GATTTGTACGTACCCTACCCGAATG -3'
Posted On2016-09-06