Mutagenetix > Incidental Mutations

Incidental Mutation 'R5398:Adam32'

429800

Institutional Source

Beutler Lab

Gene Symbol

Adam32

Ensembl Gene

ENSMUSG00000037437

Gene Name

a disintegrin and metallopeptidase domain 32

Synonyms

MMRRC Submission

042969-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24836140-24948804 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24872579 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 34 (L34P)

Ref Sequence

ENSEMBL: ENSMUSP00000133631 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119720] [ENSMUST00000121438] [ENSMUST00000173069]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119720
AA Change: L610P

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113076
Gene: ENSMUSG00000037437
AA Change: L610P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	32	145	4.5e-32	PFAM
Pfam:Reprolysin	187	384	4.1e-66	PFAM
Pfam:Reprolysin_3	211	318	6.2e-7	PFAM
DISIN	400	481	2.69e-16	SMART
ACR	482	622	6.83e-38	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121438
AA Change: L610P

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113627
Gene: ENSMUSG00000037437
AA Change: L610P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	24	145	8.4e-26	PFAM
Pfam:Reprolysin	187	384	1.3e-68	PFAM
DISIN	400	481	2.69e-16	SMART
ACR	482	622	6.83e-38	SMART
EGF	631	660	1.73e0	SMART
transmembrane domain	689	711	N/A	INTRINSIC
low complexity region	719	754	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140573

SMART Domains

Protein: ENSMUSP00000133843
Gene: ENSMUSG00000037437

Domain	Start	End	E-Value	Type
Blast:DISIN	2	22	5e-7	BLAST
Pfam:ADAM_CR	24	71	1.3e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173069
AA Change: L34P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000133631
Gene: ENSMUSG00000037437
AA Change: L34P

Domain	Start	End	E-Value	Type
Blast:ACR	1	46	7e-25	BLAST

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an metalloprotease, disintegrin and epidermal growth factor-like domains. This gene was found to be expressed predominantly in the pachytene spermatocytes, where the processed protein is localized to the sperm surface. This gene is located in a cluster of other disintegrin and metallopeptidase family genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	A	C	8: 43,651,241	C456G	probably damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Atp8b3	T	C	10: 80,529,699	D407G	probably damaging	Het
Btbd19	G	A	4: 117,123,760	A104V	probably damaging	Het
Chac1	T	G	2: 119,353,244	L109R	possibly damaging	Het
Csf2rb	A	G	15: 78,348,620	D709G	probably benign	Het
Ddx42	T	A	11: 106,224,898	D112E	probably benign	Het
Dnah5	A	G	15: 28,293,726	K1326E	probably benign	Het
Dnajc3	T	A	14: 118,972,387	Y291*	probably null	Het
Dsg2	T	C	18: 20,579,133	F109L	probably benign	Het
Egfl8	T	C	17: 34,614,639		probably benign	Het
Emb	T	A	13: 117,267,552	I280N	probably damaging	Het
Gcc2	C	A	10: 58,269,507	N188K	probably benign	Het
Gdpd4	A	T	7: 97,971,978	H166L	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Itga11	A	G	9: 62,745,923	T360A	probably benign	Het
Kctd1	A	G	18: 15,062,265	S434P	possibly damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Kif24	T	C	4: 41,394,401	E824G	possibly damaging	Het
Lekr1	T	A	3: 65,781,386		noncoding transcript	Het
Ociad1	T	A	5: 73,310,412	V231E	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr365	C	A	2: 37,201,318	Q26K	probably benign	Het
Pcdhb1	T	C	18: 37,266,154	L386P	probably damaging	Het
Pcdhb21	G	T	18: 37,515,719	V634L	probably benign	Het
Pcnx2	T	C	8: 125,887,948	K255E	possibly damaging	Het
Pex5l	T	A	3: 32,952,490	I577F	probably damaging	Het
Ppl	A	G	16: 5,104,922	M235T	probably benign	Het
Prl7d1	T	A	13: 27,710,074	I171F	probably damaging	Het
Ptprt	T	C	2: 161,927,592	Y451C	probably damaging	Het
Ranbp17	A	T	11: 33,474,998	Y453N	probably damaging	Het
Rgs16	C	T	1: 153,740,500	T11I	probably benign	Het
Rragb	G	A	X: 153,140,554	G24E	probably damaging	Het
Scn9a	T	C	2: 66,488,043	Y1479C	probably damaging	Het
Slc35f4	T	C	14: 49,298,847	T294A	probably damaging	Het
Slc39a6	A	T	18: 24,597,879	I61N	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Spink12	A	G	18: 44,107,727	D60G	possibly damaging	Het
Sppl2a	T	C	2: 126,919,718	I289V	probably benign	Het
Srebf2	A	G	15: 82,171,242	T176A	probably damaging	Het
Syce1l	T	C	8: 113,652,513	L91S	probably damaging	Het
Tchhl1	T	C	3: 93,471,603	I538T	probably benign	Het
Tcte1	C	T	17: 45,539,826	Q343*	probably null	Het
Tdpoz2	T	G	3: 93,652,134	D177A	probably damaging	Het
Thada	T	G	17: 84,426,186	D1011A	probably benign	Het
Tnn	T	A	1: 160,147,522	M112L	probably benign	Het
Traf1	T	C	2: 34,945,435	E325G	probably damaging	Het
Tyw1	T	C	5: 130,277,157		probably benign	Het
Vmn2r111	C	A	17: 22,573,271	M1I	probably null	Het
Wdr11	C	T	7: 129,631,232	T996M	probably damaging	Het

Other mutations in Adam32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00775:Adam32	APN	8	24921354	missense	probably damaging	1.00
IGL00793:Adam32	APN	8	24837830	splice site	probably benign
IGL01317:Adam32	APN	8	24872581	missense	probably damaging	1.00
IGL01475:Adam32	APN	8	24872648	missense	probably damaging	1.00
IGL01501:Adam32	APN	8	24914353	missense	probably damaging	1.00
IGL01659:Adam32	APN	8	24870774	splice site	probably benign
IGL01994:Adam32	APN	8	24902796	splice site	probably benign
IGL02137:Adam32	APN	8	24872594	missense	probably damaging	1.00
IGL02393:Adam32	APN	8	24920053	missense	probably damaging	1.00
IGL02516:Adam32	APN	8	24898596	missense	probably damaging	1.00
IGL02892:Adam32	APN	8	24878711	intron	probably benign
IGL02929:Adam32	APN	8	24872643	missense	possibly damaging	0.81
IGL03273:Adam32	APN	8	24921340	missense	probably damaging	1.00
PIT4515001:Adam32	UTSW	8	24914326	missense	possibly damaging	0.88
R0088:Adam32	UTSW	8	24914067	missense	probably damaging	1.00
R0098:Adam32	UTSW	8	24914389	missense	possibly damaging	0.79
R0098:Adam32	UTSW	8	24914389	missense	possibly damaging	0.79
R0189:Adam32	UTSW	8	24922337	critical splice acceptor site	probably null
R1740:Adam32	UTSW	8	24921298	missense	probably damaging	1.00
R1853:Adam32	UTSW	8	24898626	missense	probably benign	0.02
R2090:Adam32	UTSW	8	24901440	critical splice donor site	probably null
R2906:Adam32	UTSW	8	24863504	missense	probably damaging	1.00
R2907:Adam32	UTSW	8	24863504	missense	probably damaging	1.00
R4304:Adam32	UTSW	8	24901529	missense	probably damaging	1.00
R4612:Adam32	UTSW	8	24872736	missense	probably damaging	1.00
R4673:Adam32	UTSW	8	24884455	missense	probably damaging	1.00
R4786:Adam32	UTSW	8	24863493	missense	probably damaging	1.00
R5292:Adam32	UTSW	8	24864451	missense	possibly damaging	0.85
R5524:Adam32	UTSW	8	24922312	missense	probably damaging	0.99
R5939:Adam32	UTSW	8	24914122	missense	probably damaging	1.00
R6350:Adam32	UTSW	8	24863429	missense	possibly damaging	0.86
R6766:Adam32	UTSW	8	24872630	missense	probably damaging	0.96
R6893:Adam32	UTSW	8	24878754	missense	probably damaging	1.00
R7095:Adam32	UTSW	8	24914070	missense	probably damaging	1.00
R7241:Adam32	UTSW	8	24898494	missense	probably benign	0.00
R7457:Adam32	UTSW	8	24884619	missense	probably damaging	0.98
R7864:Adam32	UTSW	8	24922276	missense	probably benign	0.11
R8083:Adam32	UTSW	8	24872736	missense	probably damaging	1.00
R8248:Adam32	UTSW	8	24901470	missense	possibly damaging	0.93
R8376:Adam32	UTSW	8	24919920	missense	possibly damaging	0.81
Z1176:Adam32	UTSW	8	24948750	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGACGTTTAGAATTACATGGTG -3'
(R):5'- GGGAGATTGATTTGTACGTACCC -3'

Sequencing Primer
(F):5'- GATTACATTCCTAAAGCTAGCCG -3'
(R):5'- GATTTGTACGTACCCTACCCGAATG -3'

Posted On

2016-09-06