Incidental Mutation 'R5398:Or1e16'
ID 429807
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 042969-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R5398 (G1)
Quality Score 217
Status Validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73286480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 25,362,595 (GRCm39) L34P possibly damaging Het
Adam34 A C 8: 44,104,278 (GRCm39) C456G probably damaging Het
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Atp8b3 T C 10: 80,365,533 (GRCm39) D407G probably damaging Het
Btbd19 G A 4: 116,980,957 (GRCm39) A104V probably damaging Het
Chac1 T G 2: 119,183,725 (GRCm39) L109R possibly damaging Het
Csf2rb A G 15: 78,232,820 (GRCm39) D709G probably benign Het
Ddx42 T A 11: 106,115,724 (GRCm39) D112E probably benign Het
Dnah5 A G 15: 28,293,872 (GRCm39) K1326E probably benign Het
Dnajc3 T A 14: 119,209,799 (GRCm39) Y291* probably null Het
Dsg2 T C 18: 20,712,190 (GRCm39) F109L probably benign Het
Egfl8 T C 17: 34,833,613 (GRCm39) probably benign Het
Emb T A 13: 117,404,088 (GRCm39) I280N probably damaging Het
Gcc2 C A 10: 58,105,329 (GRCm39) N188K probably benign Het
Gdpd4 A T 7: 97,621,185 (GRCm39) H166L probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Itga11 A G 9: 62,653,205 (GRCm39) T360A probably benign Het
Kctd1 A G 18: 15,195,322 (GRCm39) S434P possibly damaging Het
Kdm5b G A 1: 134,549,836 (GRCm39) probably null Het
Kif24 T C 4: 41,394,401 (GRCm39) E824G possibly damaging Het
Lekr1 T A 3: 65,688,807 (GRCm39) noncoding transcript Het
Ociad1 T A 5: 73,467,755 (GRCm39) V231E probably benign Het
Or1l4 C A 2: 37,091,330 (GRCm39) Q26K probably benign Het
Pcdhb1 T C 18: 37,399,207 (GRCm39) L386P probably damaging Het
Pcdhb21 G T 18: 37,648,772 (GRCm39) V634L probably benign Het
Pcnx2 T C 8: 126,614,687 (GRCm39) K255E possibly damaging Het
Pex5l T A 3: 33,006,639 (GRCm39) I577F probably damaging Het
Ppl A G 16: 4,922,786 (GRCm39) M235T probably benign Het
Prl7d1 T A 13: 27,894,057 (GRCm39) I171F probably damaging Het
Ptprt T C 2: 161,769,512 (GRCm39) Y451C probably damaging Het
Ranbp17 A T 11: 33,424,998 (GRCm39) Y453N probably damaging Het
Rgs16 C T 1: 153,616,246 (GRCm39) T11I probably benign Het
Rragb G A X: 151,923,550 (GRCm39) G24E probably damaging Het
Scn9a T C 2: 66,318,387 (GRCm39) Y1479C probably damaging Het
Slc35f4 T C 14: 49,536,304 (GRCm39) T294A probably damaging Het
Slc39a6 A T 18: 24,730,936 (GRCm39) I61N probably damaging Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Spink12 A G 18: 44,240,794 (GRCm39) D60G possibly damaging Het
Sppl2a T C 2: 126,761,638 (GRCm39) I289V probably benign Het
Srebf2 A G 15: 82,055,443 (GRCm39) T176A probably damaging Het
Syce1l T C 8: 114,379,145 (GRCm39) L91S probably damaging Het
Tchhl1 T C 3: 93,378,910 (GRCm39) I538T probably benign Het
Tcte1 C T 17: 45,850,752 (GRCm39) Q343* probably null Het
Tdpoz2 T G 3: 93,559,441 (GRCm39) D177A probably damaging Het
Thada T G 17: 84,733,614 (GRCm39) D1011A probably benign Het
Tnn T A 1: 159,975,092 (GRCm39) M112L probably benign Het
Traf1 T C 2: 34,835,447 (GRCm39) E325G probably damaging Het
Tyw1 T C 5: 130,305,998 (GRCm39) probably benign Het
Vmn2r111 C A 17: 22,792,252 (GRCm39) M1I probably null Het
Wdr11 C T 7: 129,232,956 (GRCm39) T996M probably damaging Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTAACACGGGTGTCAGAGCAG -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On 2016-09-06