Incidental Mutation 'R5398:Gm4787'
ID 429809
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
MMRRC Submission 042969-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R5398 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 81423765-81426238 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 81424604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 518 (T518S)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: T518S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: T518S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087222
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 25,362,595 (GRCm39) L34P possibly damaging Het
Adam34 A C 8: 44,104,278 (GRCm39) C456G probably damaging Het
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Atp8b3 T C 10: 80,365,533 (GRCm39) D407G probably damaging Het
Btbd19 G A 4: 116,980,957 (GRCm39) A104V probably damaging Het
Chac1 T G 2: 119,183,725 (GRCm39) L109R possibly damaging Het
Csf2rb A G 15: 78,232,820 (GRCm39) D709G probably benign Het
Ddx42 T A 11: 106,115,724 (GRCm39) D112E probably benign Het
Dnah5 A G 15: 28,293,872 (GRCm39) K1326E probably benign Het
Dnajc3 T A 14: 119,209,799 (GRCm39) Y291* probably null Het
Dsg2 T C 18: 20,712,190 (GRCm39) F109L probably benign Het
Egfl8 T C 17: 34,833,613 (GRCm39) probably benign Het
Emb T A 13: 117,404,088 (GRCm39) I280N probably damaging Het
Gcc2 C A 10: 58,105,329 (GRCm39) N188K probably benign Het
Gdpd4 A T 7: 97,621,185 (GRCm39) H166L probably benign Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Itga11 A G 9: 62,653,205 (GRCm39) T360A probably benign Het
Kctd1 A G 18: 15,195,322 (GRCm39) S434P possibly damaging Het
Kdm5b G A 1: 134,549,836 (GRCm39) probably null Het
Kif24 T C 4: 41,394,401 (GRCm39) E824G possibly damaging Het
Lekr1 T A 3: 65,688,807 (GRCm39) noncoding transcript Het
Ociad1 T A 5: 73,467,755 (GRCm39) V231E probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or1l4 C A 2: 37,091,330 (GRCm39) Q26K probably benign Het
Pcdhb1 T C 18: 37,399,207 (GRCm39) L386P probably damaging Het
Pcdhb21 G T 18: 37,648,772 (GRCm39) V634L probably benign Het
Pcnx2 T C 8: 126,614,687 (GRCm39) K255E possibly damaging Het
Pex5l T A 3: 33,006,639 (GRCm39) I577F probably damaging Het
Ppl A G 16: 4,922,786 (GRCm39) M235T probably benign Het
Prl7d1 T A 13: 27,894,057 (GRCm39) I171F probably damaging Het
Ptprt T C 2: 161,769,512 (GRCm39) Y451C probably damaging Het
Ranbp17 A T 11: 33,424,998 (GRCm39) Y453N probably damaging Het
Rgs16 C T 1: 153,616,246 (GRCm39) T11I probably benign Het
Rragb G A X: 151,923,550 (GRCm39) G24E probably damaging Het
Scn9a T C 2: 66,318,387 (GRCm39) Y1479C probably damaging Het
Slc35f4 T C 14: 49,536,304 (GRCm39) T294A probably damaging Het
Slc39a6 A T 18: 24,730,936 (GRCm39) I61N probably damaging Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Spink12 A G 18: 44,240,794 (GRCm39) D60G possibly damaging Het
Sppl2a T C 2: 126,761,638 (GRCm39) I289V probably benign Het
Srebf2 A G 15: 82,055,443 (GRCm39) T176A probably damaging Het
Syce1l T C 8: 114,379,145 (GRCm39) L91S probably damaging Het
Tchhl1 T C 3: 93,378,910 (GRCm39) I538T probably benign Het
Tcte1 C T 17: 45,850,752 (GRCm39) Q343* probably null Het
Tdpoz2 T G 3: 93,559,441 (GRCm39) D177A probably damaging Het
Thada T G 17: 84,733,614 (GRCm39) D1011A probably benign Het
Tnn T A 1: 159,975,092 (GRCm39) M112L probably benign Het
Traf1 T C 2: 34,835,447 (GRCm39) E325G probably damaging Het
Tyw1 T C 5: 130,305,998 (GRCm39) probably benign Het
Vmn2r111 C A 17: 22,792,252 (GRCm39) M1I probably null Het
Wdr11 C T 7: 129,232,956 (GRCm39) T996M probably damaging Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81,423,948 (GRCm39) missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81,424,218 (GRCm39) missense probably benign 0.36
IGL02193:Gm4787 APN 12 81,425,302 (GRCm39) missense probably benign 0.02
IGL02623:Gm4787 APN 12 81,425,502 (GRCm39) missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81,425,543 (GRCm39) missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81,424,826 (GRCm39) missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81,425,948 (GRCm39) missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
PIT4362001:Gm4787 UTSW 12 81,423,949 (GRCm39) missense probably benign
R0070:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81,424,521 (GRCm39) nonsense probably null
R0220:Gm4787 UTSW 12 81,425,422 (GRCm39) missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81,425,708 (GRCm39) missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
R1761:Gm4787 UTSW 12 81,423,950 (GRCm39) missense probably benign 0.02
R1809:Gm4787 UTSW 12 81,425,303 (GRCm39) missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81,425,544 (GRCm39) missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81,425,694 (GRCm39) missense probably benign 0.39
R2112:Gm4787 UTSW 12 81,424,607 (GRCm39) missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81,425,336 (GRCm39) missense probably benign 0.03
R2151:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2152:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2342:Gm4787 UTSW 12 81,425,532 (GRCm39) missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81,425,911 (GRCm39) missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81,425,132 (GRCm39) missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81,425,987 (GRCm39) missense probably benign 0.17
R4748:Gm4787 UTSW 12 81,424,830 (GRCm39) missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81,425,141 (GRCm39) missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81,425,612 (GRCm39) missense probably benign 0.03
R4960:Gm4787 UTSW 12 81,426,090 (GRCm39) missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81,424,403 (GRCm39) missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5029:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5031:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5098:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5099:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5100:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5101:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5135:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5152:Gm4787 UTSW 12 81,425,451 (GRCm39) missense probably benign 0.02
R5180:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5220:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5257:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5258:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5297:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5324:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5325:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5355:Gm4787 UTSW 12 81,424,239 (GRCm39) nonsense probably null
R5364:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5396:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5397:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5514:Gm4787 UTSW 12 81,425,102 (GRCm39) missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5666:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5670:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5787:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5788:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R6354:Gm4787 UTSW 12 81,424,755 (GRCm39) missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81,425,974 (GRCm39) missense probably benign 0.04
R7120:Gm4787 UTSW 12 81,425,260 (GRCm39) missense probably benign 0.00
R7237:Gm4787 UTSW 12 81,424,442 (GRCm39) missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81,424,679 (GRCm39) missense probably benign 0.01
R8022:Gm4787 UTSW 12 81,424,494 (GRCm39) missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81,424,925 (GRCm39) missense probably benign 0.00
R8314:Gm4787 UTSW 12 81,425,909 (GRCm39) missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81,424,280 (GRCm39) missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81,424,043 (GRCm39) missense probably benign 0.00
R9103:Gm4787 UTSW 12 81,425,489 (GRCm39) missense probably benign 0.06
R9457:Gm4787 UTSW 12 81,426,020 (GRCm39) missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81,426,074 (GRCm39) nonsense probably null
R9608:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
V7580:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7581:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7582:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACGCTTGACACCATCACAG -3'
(R):5'- CAGGGCAGCTCTTGTAATAAAG -3'

Sequencing Primer
(F):5'- GCTTGACACCATCACAGTGGAG -3'
(R):5'- CAGCTCTTGTAATAAAGGAGGTTGC -3'
Posted On 2016-09-06