Incidental Mutation 'R5399:Msc'
ID429830
Institutional Source Beutler Lab
Gene Symbol Msc
Ensembl Gene ENSMUSG00000025930
Gene Namemusculin
SynonymsbHLHa22, MyoR
MMRRC Submission 042970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5399 (G1)
Quality Score146
Status Not validated
Chromosome1
Chromosomal Location14753346-14755992 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14755556 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 65 (C65S)
Ref Sequence ENSEMBL: ENSMUSP00000027062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027062] [ENSMUST00000190719]
Predicted Effect probably benign
Transcript: ENSMUST00000027062
AA Change: C65S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027062
Gene: ENSMUSG00000025930
AA Change: C65S

DomainStartEndE-ValueType
low complexity region 48 55 N/A INTRINSIC
low complexity region 66 94 N/A INTRINSIC
HLH 108 160 1.8e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067599
SMART Domains Protein: ENSMUSP00000063770
Gene: ENSMUSG00000054493

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190471
Predicted Effect probably benign
Transcript: ENSMUST00000190719
SMART Domains Protein: ENSMUSP00000140741
Gene: ENSMUSG00000025930

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional repressor capable of binding an E-box element either as a homodimer or as a heterodimer with E2A in vitro. The encoded protein also forms heterodimers with E2A proteins in vivo. This protein is capable of inhibiting the transactivation capability of E47, an E2A protein, in mammalian cells. This gene is a downstream target of the B-cell receptor signal transduction pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are obtained at predicted Mendelian ratios and exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,440,868 L214F probably damaging Het
Abcb1b T C 5: 8,827,410 S657P probably benign Het
Abcb5 T A 12: 118,911,499 Y646F probably benign Het
Agl A T 3: 116,781,628 L620Q probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Arhgap23 A G 11: 97,500,917 N1420S probably damaging Het
Arntl2 T G 6: 146,822,661 D350E probably damaging Het
Barx2 A G 9: 31,854,111 probably null Het
Birc6 C A 17: 74,604,578 S28R possibly damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Casp4 A T 9: 5,324,928 K247* probably null Het
Clk4 T C 11: 51,275,257 Y17H probably damaging Het
Cntnap1 A G 11: 101,183,316 Q722R probably benign Het
Col6a6 A G 9: 105,709,107 V1905A possibly damaging Het
Csmd1 C A 8: 16,710,597 G174V probably damaging Het
Cul1 T A 6: 47,485,084 probably null Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Dnaaf2 A G 12: 69,196,742 I515T probably damaging Het
Fbn1 T C 2: 125,332,333 I1868V possibly damaging Het
Fcgbp G T 7: 28,105,055 V1863L probably benign Het
G2e3 T C 12: 51,357,194 probably null Het
Gabrr2 T C 4: 33,071,458 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gbgt1 C T 2: 28,503,218 P106L probably damaging Het
Gm13023 T C 4: 143,795,032 F406S probably benign Het
Gm6657 A C 12: 78,197,453 N60T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,205,024 E927G probably damaging Het
Hfm1 T A 5: 106,917,562 I84F possibly damaging Het
Htt G T 5: 34,877,151 D1989Y probably damaging Het
Ihh C T 1: 74,946,277 A350T probably benign Het
Irx4 G C 13: 73,265,539 A43P probably benign Het
Itk A G 11: 46,338,111 V414A probably benign Het
Itsn2 A T 12: 4,653,535 I744L probably benign Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Morc3 A G 16: 93,862,539 probably null Het
Mybpc1 A G 10: 88,523,014 V343A probably damaging Het
Myo5c T C 9: 75,288,074 I1218T possibly damaging Het
Mypn C T 10: 63,120,186 V1163I probably benign Het
Obox3 A T 7: 15,626,288 M152K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1204 T A 2: 88,852,655 L235H probably damaging Het
Olfr1264 T A 2: 90,021,923 T48S probably benign Het
Olfr328 A G 11: 58,552,143 V32A probably benign Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prss23 A T 7: 89,509,966 D298E probably benign Het
Rab4b A T 7: 27,176,162 N31K probably benign Het
Ros1 A G 10: 52,090,944 probably null Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Rtl1 A T 12: 109,590,302 L1701Q probably damaging Het
Sbno1 T A 5: 124,392,741 N831Y probably benign Het
Selp A G 1: 164,126,586 K152E possibly damaging Het
Sema4b A G 7: 80,224,886 T675A probably benign Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Slco1a4 T A 6: 141,830,707 I196F probably damaging Het
Spata13 G A 14: 60,747,541 S828N probably benign Het
Stard13 A T 5: 151,047,801 Y643* probably null Het
Tll1 T C 8: 64,085,488 H374R probably damaging Het
Trmt10a T A 3: 138,147,504 I42K probably damaging Het
Trmu A T 15: 85,896,408 probably null Het
Trp53 T A 11: 69,588,546 D183E probably benign Het
Ttc22 T G 4: 106,636,757 F305V probably damaging Het
Unc13c A G 9: 73,749,688 F1077S possibly damaging Het
Utrn T A 10: 12,640,983 Q2289L probably damaging Het
Vmn1r65 C A 7: 6,008,810 E142* probably null Het
Vmn2r63 A T 7: 42,928,277 V279D probably benign Het
Zfp810 G A 9: 22,278,829 T261I possibly damaging Het
Zkscan17 A G 11: 59,502,918 probably null Het
Other mutations in Msc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2081:Msc UTSW 1 14755717 missense probably benign 0.24
R2094:Msc UTSW 1 14755684 missense probably benign 0.27
R2495:Msc UTSW 1 14755249 missense probably benign 0.14
R4409:Msc UTSW 1 14755678 missense probably damaging 0.97
R4470:Msc UTSW 1 14755678 missense probably damaging 0.97
R4471:Msc UTSW 1 14755678 missense probably damaging 0.97
R4654:Msc UTSW 1 14755829 unclassified probably null
R5073:Msc UTSW 1 14754313 missense probably benign 0.02
R5385:Msc UTSW 1 14755420 missense probably damaging 1.00
R6547:Msc UTSW 1 14755745 missense possibly damaging 0.95
R6799:Msc UTSW 1 14755267 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGGAGAAGGCTTTGCTC -3'
(R):5'- TACAGGGTCAGCAGCAGATC -3'

Sequencing Primer
(F):5'- AGAAGGCTTTGCTCAGCAC -3'
(R):5'- AATAGGCGATGTCCACCGG -3'
Posted On2016-09-06