Mutagenetix > Incidental Mutation

Incidental Mutation 'R5399:Kdm5b'

429832

Institutional Source

Beutler Lab

Gene Symbol

Kdm5b

Ensembl Gene

ENSMUSG00000042207

Gene Name

lysine (K)-specific demethylase 5B

Synonyms

Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e

MMRRC Submission

042970-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R5399 (G1)

Quality Score

215

Status

Not validated

Chromosome

Chromosomal Location

134560171-134635285 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 134622098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]

AlphaFold

Q80Y84

PDB Structure

Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000047714

SMART Domains

Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	744	2.2e-17	PFAM
Pfam:PLU-1	757	1088	5.6e-92	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC
PHD	1486	1536	1.18e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112198

SMART Domains

Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	745	6.7e-21	PFAM
Pfam:PLU-1	756	1088	6e-94	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133725

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191572

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	G	T	2: 152,440,868	L214F	probably damaging	Het
Abcb1b	T	C	5: 8,827,410	S657P	probably benign	Het
Abcb5	T	A	12: 118,911,499	Y646F	probably benign	Het
Agl	A	T	3: 116,781,628	L620Q	probably damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Arhgap23	A	G	11: 97,500,917	N1420S	probably damaging	Het
Arntl2	T	G	6: 146,822,661	D350E	probably damaging	Het
Barx2	A	G	9: 31,854,111		probably null	Het
Birc6	C	A	17: 74,604,578	S28R	possibly damaging	Het
Btbd19	G	A	4: 117,123,760	A104V	probably damaging	Het
Casp4	A	T	9: 5,324,928	K247*	probably null	Het
Clk4	T	C	11: 51,275,257	Y17H	probably damaging	Het
Cntnap1	A	G	11: 101,183,316	Q722R	probably benign	Het
Col6a6	A	G	9: 105,709,107	V1905A	possibly damaging	Het
Csmd1	C	A	8: 16,710,597	G174V	probably damaging	Het
Cul1	T	A	6: 47,485,084		probably null	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Dnaaf2	A	G	12: 69,196,742	I515T	probably damaging	Het
Fbn1	T	C	2: 125,332,333	I1868V	possibly damaging	Het
Fcgbp	G	T	7: 28,105,055	V1863L	probably benign	Het
G2e3	T	C	12: 51,357,194		probably null	Het
Gabrr2	T	C	4: 33,071,458		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gbgt1	C	T	2: 28,503,218	P106L	probably damaging	Het
Gm13023	T	C	4: 143,795,032	F406S	probably benign	Het
Gm6657	A	C	12: 78,197,453	N60T	probably damaging	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Golga3	A	G	5: 110,205,024	E927G	probably damaging	Het
Hfm1	T	A	5: 106,917,562	I84F	possibly damaging	Het
Htt	G	T	5: 34,877,151	D1989Y	probably damaging	Het
Ihh	C	T	1: 74,946,277	A350T	probably benign	Het
Irx4	G	C	13: 73,265,539	A43P	probably benign	Het
Itk	A	G	11: 46,338,111	V414A	probably benign	Het
Itsn2	A	T	12: 4,653,535	I744L	probably benign	Het
Kif14	A	G	1: 136,503,324	D1153G	probably benign	Het
Morc3	A	G	16: 93,862,539		probably null	Het
Msc	A	T	1: 14,755,556	C65S	probably benign	Het
Mybpc1	A	G	10: 88,523,014	V343A	probably damaging	Het
Myo5c	T	C	9: 75,288,074	I1218T	possibly damaging	Het
Mypn	C	T	10: 63,120,186	V1163I	probably benign	Het
Obox3	A	T	7: 15,626,288	M152K	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1204	T	A	2: 88,852,655	L235H	probably damaging	Het
Olfr1264	T	A	2: 90,021,923	T48S	probably benign	Het
Olfr328	A	G	11: 58,552,143	V32A	probably benign	Het
Pcdhb21	G	T	18: 37,515,719	V634L	probably benign	Het
Ppp1r9b	G	A	11: 94,992,148	A201T	probably benign	Het
Prss23	A	T	7: 89,509,966	D298E	probably benign	Het
Rab4b	A	T	7: 27,176,162	N31K	probably benign	Het
Ros1	A	G	10: 52,090,944		probably null	Het
Rragb	G	A	X: 153,140,554	G24E	probably damaging	Het
Rtl1	A	T	12: 109,590,302	L1701Q	probably damaging	Het
Sbno1	T	A	5: 124,392,741	N831Y	probably benign	Het
Selp	A	G	1: 164,126,586	K152E	possibly damaging	Het
Sema4b	A	G	7: 80,224,886	T675A	probably benign	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Slco1a4	T	A	6: 141,830,707	I196F	probably damaging	Het
Spata13	G	A	14: 60,747,541	S828N	probably benign	Het
Stard13	A	T	5: 151,047,801	Y643*	probably null	Het
Tll1	T	C	8: 64,085,488	H374R	probably damaging	Het
Trmt10a	T	A	3: 138,147,504	I42K	probably damaging	Het
Trmu	A	T	15: 85,896,408		probably null	Het
Trp53	T	A	11: 69,588,546	D183E	probably benign	Het
Ttc22	T	G	4: 106,636,757	F305V	probably damaging	Het
Unc13c	A	G	9: 73,749,688	F1077S	possibly damaging	Het
Utrn	T	A	10: 12,640,983	Q2289L	probably damaging	Het
Vmn1r65	C	A	7: 6,008,810	E142*	probably null	Het
Vmn2r63	A	T	7: 42,928,277	V279D	probably benign	Het
Zfp810	G	A	9: 22,278,829	T261I	possibly damaging	Het
Zkscan17	A	G	11: 59,502,918		probably null	Het

Other mutations in Kdm5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kdm5b	APN	1	134620955	missense	probably damaging	1.00
IGL01458:Kdm5b	APN	1	134621986	missense	possibly damaging	0.53
IGL01567:Kdm5b	APN	1	134602540	missense	probably damaging	1.00
IGL01625:Kdm5b	APN	1	134617968	missense	possibly damaging	0.74
IGL01970:Kdm5b	APN	1	134600727	missense	probably damaging	1.00
IGL02183:Kdm5b	APN	1	134624931	missense	probably benign	0.09
IGL02592:Kdm5b	APN	1	134624853	missense	probably damaging	0.99
IGL02695:Kdm5b	APN	1	134604485	missense	possibly damaging	0.94
IGL02697:Kdm5b	APN	1	134588773	splice site	probably benign
IGL03036:Kdm5b	APN	1	134608937	missense	probably damaging	1.00
IGL03056:Kdm5b	APN	1	134587979	missense	probably damaging	0.99
IGL03206:Kdm5b	APN	1	134627317	missense	probably benign
IGL03342:Kdm5b	APN	1	134602576	missense	probably benign	0.00
IGL03388:Kdm5b	APN	1	134627322	missense	probably benign
amaryllis	UTSW	1	134609061	critical splice donor site	probably null
PIT4486001:Kdm5b	UTSW	1	134628685	missense	probably damaging	1.00
R0233:Kdm5b	UTSW	1	134604634	splice site	probably benign
R0334:Kdm5b	UTSW	1	134604522	missense	probably damaging	0.99
R0504:Kdm5b	UTSW	1	134621023	critical splice donor site	probably null
R0505:Kdm5b	UTSW	1	134602571	missense	probably damaging	0.96
R0521:Kdm5b	UTSW	1	134618033	missense	possibly damaging	0.65
R1004:Kdm5b	UTSW	1	134588904	missense	possibly damaging	0.71
R1087:Kdm5b	UTSW	1	134600637	missense	probably damaging	1.00
R1126:Kdm5b	UTSW	1	134613991	missense	possibly damaging	0.90
R1221:Kdm5b	UTSW	1	134599091	missense	probably damaging	0.98
R1230:Kdm5b	UTSW	1	134613254	missense	probably damaging	1.00
R1345:Kdm5b	UTSW	1	134630550	missense	possibly damaging	0.94
R1482:Kdm5b	UTSW	1	134624897	missense	probably damaging	1.00
R1582:Kdm5b	UTSW	1	134624853	missense	probably damaging	0.99
R1653:Kdm5b	UTSW	1	134602481	missense	probably damaging	1.00
R1693:Kdm5b	UTSW	1	134597576	splice site	probably benign
R1721:Kdm5b	UTSW	1	134613181	splice site	probably benign
R1741:Kdm5b	UTSW	1	134618017	missense	possibly damaging	0.82
R1762:Kdm5b	UTSW	1	134604467	nonsense	probably null
R1820:Kdm5b	UTSW	1	134597670	missense	possibly damaging	0.87
R1872:Kdm5b	UTSW	1	134624994	missense	probably damaging	1.00
R1966:Kdm5b	UTSW	1	134613873	splice site	probably null
R2056:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2059:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2405:Kdm5b	UTSW	1	134609016	missense	probably damaging	0.97
R3417:Kdm5b	UTSW	1	134587977	missense	probably damaging	1.00
R3771:Kdm5b	UTSW	1	134613345	missense	probably damaging	1.00
R3783:Kdm5b	UTSW	1	134630542	missense	probably benign
R3803:Kdm5b	UTSW	1	134615941	missense	probably benign	0.07
R3980:Kdm5b	UTSW	1	134619670	missense	probably benign	0.11
R3983:Kdm5b	UTSW	1	134631304	missense	possibly damaging	0.91
R4013:Kdm5b	UTSW	1	134627329	missense	possibly damaging	0.86
R4162:Kdm5b	UTSW	1	134625161	missense	probably benign	0.01
R4701:Kdm5b	UTSW	1	134606012	intron	probably benign
R4791:Kdm5b	UTSW	1	134630800	missense	possibly damaging	0.82
R4836:Kdm5b	UTSW	1	134593315	splice site	probably null
R4924:Kdm5b	UTSW	1	134631351	missense	probably benign	0.00
R5135:Kdm5b	UTSW	1	134588746	intron	probably benign
R5248:Kdm5b	UTSW	1	134620997	missense	probably benign	0.11
R5290:Kdm5b	UTSW	1	134622099	splice site	probably null
R5358:Kdm5b	UTSW	1	134607694	nonsense	probably null
R5388:Kdm5b	UTSW	1	134608897	nonsense	probably null
R5396:Kdm5b	UTSW	1	134622098	splice site	probably null
R5397:Kdm5b	UTSW	1	134622098	splice site	probably null
R5398:Kdm5b	UTSW	1	134622098	splice site	probably null
R5529:Kdm5b	UTSW	1	134588003	missense	probably damaging	1.00
R5540:Kdm5b	UTSW	1	134631241	missense	probably damaging	0.98
R5661:Kdm5b	UTSW	1	134599073	missense	probably benign	0.01
R5663:Kdm5b	UTSW	1	134630635	missense	probably benign
R5822:Kdm5b	UTSW	1	134588773	splice site	probably benign
R6226:Kdm5b	UTSW	1	134608878	missense	probably damaging	0.99
R6368:Kdm5b	UTSW	1	134599207	missense	probably damaging	1.00
R6681:Kdm5b	UTSW	1	134613269	missense	possibly damaging	0.90
R6715:Kdm5b	UTSW	1	134609061	critical splice donor site	probably null
R7132:Kdm5b	UTSW	1	134599106	missense	probably damaging	1.00
R7202:Kdm5b	UTSW	1	134624759	missense	probably benign
R7258:Kdm5b	UTSW	1	134621021	missense	probably damaging	1.00
R7335:Kdm5b	UTSW	1	134560439	missense	probably damaging	1.00
R7420:Kdm5b	UTSW	1	134604497	missense	probably benign	0.14
R7426:Kdm5b	UTSW	1	134595833	missense	probably benign	0.02
R7452:Kdm5b	UTSW	1	134624948	missense	probably damaging	1.00
R7595:Kdm5b	UTSW	1	134608966	missense	probably benign	0.00
R7612:Kdm5b	UTSW	1	134624918	nonsense	probably null
R7704:Kdm5b	UTSW	1	134587931	missense	probably damaging	1.00
R7846:Kdm5b	UTSW	1	134617840	missense	probably damaging	1.00
R8115:Kdm5b	UTSW	1	134619673	missense	possibly damaging	0.83
R8146:Kdm5b	UTSW	1	134625126	missense	probably benign	0.05
R8160:Kdm5b	UTSW	1	134613919	missense	probably damaging	1.00
R8527:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8542:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8930:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8932:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8950:Kdm5b	UTSW	1	134613926	missense	possibly damaging	0.84
R9089:Kdm5b	UTSW	1	134607768	missense	probably damaging	0.98
R9109:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9133:Kdm5b	UTSW	1	134602585	missense	probably benign
R9298:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9423:Kdm5b	UTSW	1	134587967	missense	possibly damaging	0.85
R9630:Kdm5b	UTSW	1	134585233	critical splice donor site	probably null
R9670:Kdm5b	UTSW	1	134630502	nonsense	probably null
X0063:Kdm5b	UTSW	1	134588876	missense	probably benign	0.07
Z1176:Kdm5b	UTSW	1	134625035	missense	probably damaging	1.00
Z1177:Kdm5b	UTSW	1	134595798	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGAAGTCTGTTTCACCATTGGC -3'
(R):5'- TCATTAATGCCAGGCAAGGG -3'

Sequencing Primer
(F):5'- GGCTCTGTTTTCTCTTACATTAGG -3'
(R):5'- AGGCAAGGGCTTTACCACTG -3'

Posted On

2016-09-06