Mutagenetix > Incidental Mutations

Incidental Mutation 'R5399:Kif14'

429833

Institutional Source

Beutler Lab

Gene Symbol

Kif14

Ensembl Gene

ENSMUSG00000041498

Gene Name

kinesin family member 14

Synonyms

N-3 kinesin, D1Ertd367e

MMRRC Submission

042970-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R5399 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136466343-136531511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136503324 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1153 (D1153G)

Ref Sequence

ENSEMBL: ENSMUSP00000139698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]

PDB Structure

Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000047817
AA Change: D1103G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: D1103G

Domain	Start	End	E-Value	Type
KISc	341	694	1.45e-180	SMART
FHA	809	861	1.46e-7	SMART
coiled coil region	911	1060	N/A	INTRINSIC
low complexity region	1169	1179	N/A	INTRINSIC
low complexity region	1548	1559	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000088648

Predicted Effect

probably benign
Transcript: ENSMUST00000189413
AA Change: D1153G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: D1153G

Domain	Start	End	E-Value	Type
low complexity region	278	290	N/A	INTRINSIC
KISc	391	744	1.45e-180	SMART
FHA	859	911	1.46e-7	SMART
coiled coil region	961	1110	N/A	INTRINSIC
low complexity region	1219	1229	N/A	INTRINSIC
low complexity region	1598	1609	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201676

SMART Domains

Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

Domain	Start	End	E-Value	Type
low complexity region	278	290	N/A	INTRINSIC
KISc	391	497	3.7e-6	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	G	T	2: 152,440,868	L214F	probably damaging	Het
Abcb1b	T	C	5: 8,827,410	S657P	probably benign	Het
Abcb5	T	A	12: 118,911,499	Y646F	probably benign	Het
Agl	A	T	3: 116,781,628	L620Q	probably damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Arhgap23	A	G	11: 97,500,917	N1420S	probably damaging	Het
Arntl2	T	G	6: 146,822,661	D350E	probably damaging	Het
Barx2	A	G	9: 31,854,111		probably null	Het
Birc6	C	A	17: 74,604,578	S28R	possibly damaging	Het
Btbd19	G	A	4: 117,123,760	A104V	probably damaging	Het
Casp4	A	T	9: 5,324,928	K247*	probably null	Het
Clk4	T	C	11: 51,275,257	Y17H	probably damaging	Het
Cntnap1	A	G	11: 101,183,316	Q722R	probably benign	Het
Col6a6	A	G	9: 105,709,107	V1905A	possibly damaging	Het
Csmd1	C	A	8: 16,710,597	G174V	probably damaging	Het
Cul1	T	A	6: 47,485,084		probably null	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Dnaaf2	A	G	12: 69,196,742	I515T	probably damaging	Het
Fbn1	T	C	2: 125,332,333	I1868V	possibly damaging	Het
Fcgbp	G	T	7: 28,105,055	V1863L	probably benign	Het
G2e3	T	C	12: 51,357,194		probably null	Het
Gabrr2	T	C	4: 33,071,458		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gbgt1	C	T	2: 28,503,218	P106L	probably damaging	Het
Gm13023	T	C	4: 143,795,032	F406S	probably benign	Het
Gm6657	A	C	12: 78,197,453	N60T	probably damaging	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Golga3	A	G	5: 110,205,024	E927G	probably damaging	Het
Hfm1	T	A	5: 106,917,562	I84F	possibly damaging	Het
Htt	G	T	5: 34,877,151	D1989Y	probably damaging	Het
Ihh	C	T	1: 74,946,277	A350T	probably benign	Het
Irx4	G	C	13: 73,265,539	A43P	probably benign	Het
Itk	A	G	11: 46,338,111	V414A	probably benign	Het
Itsn2	A	T	12: 4,653,535	I744L	probably benign	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Morc3	A	G	16: 93,862,539		probably null	Het
Msc	A	T	1: 14,755,556	C65S	probably benign	Het
Mybpc1	A	G	10: 88,523,014	V343A	probably damaging	Het
Myo5c	T	C	9: 75,288,074	I1218T	possibly damaging	Het
Mypn	C	T	10: 63,120,186	V1163I	probably benign	Het
Obox3	A	T	7: 15,626,288	M152K	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1204	T	A	2: 88,852,655	L235H	probably damaging	Het
Olfr1264	T	A	2: 90,021,923	T48S	probably benign	Het
Olfr328	A	G	11: 58,552,143	V32A	probably benign	Het
Pcdhb21	G	T	18: 37,515,719	V634L	probably benign	Het
Ppp1r9b	G	A	11: 94,992,148	A201T	probably benign	Het
Prss23	A	T	7: 89,509,966	D298E	probably benign	Het
Rab4b	A	T	7: 27,176,162	N31K	probably benign	Het
Ros1	A	G	10: 52,090,944		probably null	Het
Rragb	G	A	X: 153,140,554	G24E	probably damaging	Het
Rtl1	A	T	12: 109,590,302	L1701Q	probably damaging	Het
Sbno1	T	A	5: 124,392,741	N831Y	probably benign	Het
Selp	A	G	1: 164,126,586	K152E	possibly damaging	Het
Sema4b	A	G	7: 80,224,886	T675A	probably benign	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Slco1a4	T	A	6: 141,830,707	I196F	probably damaging	Het
Spata13	G	A	14: 60,747,541	S828N	probably benign	Het
Stard13	A	T	5: 151,047,801	Y643*	probably null	Het
Tll1	T	C	8: 64,085,488	H374R	probably damaging	Het
Trmt10a	T	A	3: 138,147,504	I42K	probably damaging	Het
Trmu	A	T	15: 85,896,408		probably null	Het
Trp53	T	A	11: 69,588,546	D183E	probably benign	Het
Ttc22	T	G	4: 106,636,757	F305V	probably damaging	Het
Unc13c	A	G	9: 73,749,688	F1077S	possibly damaging	Het
Utrn	T	A	10: 12,640,983	Q2289L	probably damaging	Het
Vmn1r65	C	A	7: 6,008,810	E142*	probably null	Het
Vmn2r63	A	T	7: 42,928,277	V279D	probably benign	Het
Zfp810	G	A	9: 22,278,829	T261I	possibly damaging	Het
Zkscan17	A	G	11: 59,502,918		probably null	Het

Other mutations in Kif14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00159:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00160:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00164:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00310:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00330:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00335:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00434:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00468:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL01330:Kif14	APN	1	136476374	missense	probably damaging	0.99
IGL01530:Kif14	APN	1	136478419	splice site	probably benign
IGL01622:Kif14	APN	1	136497356	splice site	probably benign
IGL01689:Kif14	APN	1	136519642	missense	probably damaging	0.99
IGL02115:Kif14	APN	1	136496567	splice site	probably benign
IGL02252:Kif14	APN	1	136478392	missense	probably damaging	1.00
IGL02259:Kif14	APN	1	136500102	missense	probably benign
IGL02439:Kif14	APN	1	136490261	missense	probably damaging	1.00
IGL02590:Kif14	APN	1	136496004	missense	probably benign	0.00
IGL02606:Kif14	APN	1	136496593	missense	probably damaging	1.00
IGL03253:Kif14	APN	1	136487460	missense	probably damaging	0.97
R0106:Kif14	UTSW	1	136479924	splice site	probably benign
R0193:Kif14	UTSW	1	136468438	missense	probably benign	0.00
R0238:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0238:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0239:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0239:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0329:Kif14	UTSW	1	136496026	splice site	probably benign
R0346:Kif14	UTSW	1	136468160	missense	probably damaging	1.00
R0393:Kif14	UTSW	1	136482418	missense	probably damaging	1.00
R0519:Kif14	UTSW	1	136469147	missense	probably damaging	1.00
R0590:Kif14	UTSW	1	136482472	missense	probably damaging	0.97
R0633:Kif14	UTSW	1	136527305	missense	probably damaging	0.96
R0657:Kif14	UTSW	1	136469102	missense	probably benign	0.07
R0831:Kif14	UTSW	1	136525871	splice site	probably benign
R0971:Kif14	UTSW	1	136519654	missense	probably damaging	0.98
R1018:Kif14	UTSW	1	136495841	splice site	probably benign
R1520:Kif14	UTSW	1	136503324	missense	probably benign	0.00
R1713:Kif14	UTSW	1	136527464	missense	probably benign	0.00
R1728:Kif14	UTSW	1	136468279	missense	probably benign
R1728:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1728:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1728:Kif14	UTSW	1	136490332	missense	probably benign
R1728:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1728:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1728:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1729:Kif14	UTSW	1	136468279	missense	probably benign
R1729:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1729:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1729:Kif14	UTSW	1	136490332	missense	probably benign
R1729:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1729:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1729:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1730:Kif14	UTSW	1	136468279	missense	probably benign
R1730:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1730:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1730:Kif14	UTSW	1	136490332	missense	probably benign
R1730:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1730:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1730:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1739:Kif14	UTSW	1	136468279	missense	probably benign
R1739:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1739:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1739:Kif14	UTSW	1	136490332	missense	probably benign
R1739:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1739:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1739:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1762:Kif14	UTSW	1	136468279	missense	probably benign
R1762:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1762:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1762:Kif14	UTSW	1	136490332	missense	probably benign
R1762:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1762:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1762:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1783:Kif14	UTSW	1	136468279	missense	probably benign
R1783:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1783:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1783:Kif14	UTSW	1	136490332	missense	probably benign
R1783:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1783:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1783:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1784:Kif14	UTSW	1	136468279	missense	probably benign
R1784:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1784:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1784:Kif14	UTSW	1	136490332	missense	probably benign
R1784:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1784:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1784:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1785:Kif14	UTSW	1	136468279	missense	probably benign
R1785:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1785:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1785:Kif14	UTSW	1	136490332	missense	probably benign
R1785:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1785:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1785:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1872:Kif14	UTSW	1	136486358	missense	probably damaging	1.00
R2049:Kif14	UTSW	1	136487080	missense	probably benign
R2049:Kif14	UTSW	1	136510167	missense	possibly damaging	0.68
R2268:Kif14	UTSW	1	136519748	nonsense	probably null
R2373:Kif14	UTSW	1	136479845	missense	probably damaging	1.00
R3076:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R3077:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R3078:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R4232:Kif14	UTSW	1	136516363	nonsense	probably null
R4246:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4247:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4250:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4672:Kif14	UTSW	1	136521278	missense	probably benign	0.00
R4672:Kif14	UTSW	1	136521279	missense	probably benign
R4890:Kif14	UTSW	1	136487130	missense	possibly damaging	0.91
R4994:Kif14	UTSW	1	136482959	missense	probably damaging	1.00
R5102:Kif14	UTSW	1	136516403	missense	probably benign	0.00
R5185:Kif14	UTSW	1	136527469	nonsense	probably null
R5201:Kif14	UTSW	1	136503407	missense	probably benign	0.00
R5431:Kif14	UTSW	1	136496695	missense	possibly damaging	0.91
R5932:Kif14	UTSW	1	136516390	missense	probably benign	0.23
R6027:Kif14	UTSW	1	136483059	intron	probably null
R6246:Kif14	UTSW	1	136476424	nonsense	probably null
R6331:Kif14	UTSW	1	136515986	missense	probably null	1.00
R6448:Kif14	UTSW	1	136503347	missense	probably damaging	0.99
R6453:Kif14	UTSW	1	136482304	intron	probably null
R6475:Kif14	UTSW	1	136527411	missense	probably damaging	1.00
R6631:Kif14	UTSW	1	136515959	missense	probably benign	0.39
R6713:Kif14	UTSW	1	136525806	missense	probably benign
R7173:Kif14	UTSW	1	136479170	missense	probably damaging	0.98
R7174:Kif14	UTSW	1	136521257	missense	possibly damaging	0.67
R7241:Kif14	UTSW	1	136468753	missense	probably benign	0.41
R7674:Kif14	UTSW	1	136468820	missense	probably damaging	0.99
R7688:Kif14	UTSW	1	136494654	missense	probably damaging	1.00
R7711:Kif14	UTSW	1	136471453	missense	probably benign	0.10
R7722:Kif14	UTSW	1	136468295	missense	probably benign	0.00
R7763:Kif14	UTSW	1	136516383	missense	probably benign	0.00
R7882:Kif14	UTSW	1	136471576	critical splice donor site	probably null
R7882:Kif14	UTSW	1	136516025	missense	probably benign	0.43
R7965:Kif14	UTSW	1	136471576	critical splice donor site	probably null
R7965:Kif14	UTSW	1	136516025	missense	probably benign	0.43
X0021:Kif14	UTSW	1	136490276	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATTCCATGTTATTCCATGTTCA -3'
(R):5'- TTTCTTTTGGGAGGAGCAGAGA -3'

Sequencing Primer
(F):5'- ATGTGCTGTGTCACCAAGC -3'
(R):5'- CTGTGATCATAGGCATGCATGACC -3'

Posted On

2016-09-06