Incidental Mutation 'R5399:Abcb1b'
ID429849
Institutional Source Beutler Lab
Gene Symbol Abcb1b
Ensembl Gene ENSMUSG00000028970
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1B
SynonymsPgy-1, Abcb1, Mdr1, mdr, Pgy1, Mdr1b
MMRRC Submission 042970-MU
Accession Numbers

Genbank: NM_011075; MGI: 97568  

Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R5399 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8798147-8866315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8827410 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 657 (S657P)
Ref Sequence ENSEMBL: ENSMUSP00000009058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009058] [ENSMUST00000199955]
Predicted Effect probably benign
Transcript: ENSMUST00000009058
AA Change: S657P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009058
Gene: ENSMUSG00000028970
AA Change: S657P

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 342 1.4e-96 PFAM
AAA 418 610 4.32e-21 SMART
Pfam:ABC_membrane 709 984 1.9e-75 PFAM
AAA 1060 1248 4.13e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199546
Predicted Effect probably benign
Transcript: ENSMUST00000199955
SMART Domains Protein: ENSMUSP00000143766
Gene: ENSMUSG00000028970

DomainStartEndE-ValueType
PDB:4M2T|B 1 78 2e-26 PDB
Blast:AAA 33 78 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene encodes a membrane glycoprotein which confers a multidrug-resistance phenotype. The protein encoded by the human gene is an ATP-dependent drug efflux pump for xenobiotic compounds which is responsible for decreased drug accumulation in multidrug-resistant cells and mediates the development of resistance to anticancer drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are hypersensitive to effects of drugs transported by phosphoglycoproteins. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Gene trapped(8)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,440,868 L214F probably damaging Het
Abcb5 T A 12: 118,911,499 Y646F probably benign Het
Agl A T 3: 116,781,628 L620Q probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Arhgap23 A G 11: 97,500,917 N1420S probably damaging Het
Arntl2 T G 6: 146,822,661 D350E probably damaging Het
Barx2 A G 9: 31,854,111 probably null Het
Birc6 C A 17: 74,604,578 S28R possibly damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Casp4 A T 9: 5,324,928 K247* probably null Het
Clk4 T C 11: 51,275,257 Y17H probably damaging Het
Cntnap1 A G 11: 101,183,316 Q722R probably benign Het
Col6a6 A G 9: 105,709,107 V1905A possibly damaging Het
Csmd1 C A 8: 16,710,597 G174V probably damaging Het
Cul1 T A 6: 47,485,084 probably null Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Dnaaf2 A G 12: 69,196,742 I515T probably damaging Het
Fbn1 T C 2: 125,332,333 I1868V possibly damaging Het
Fcgbp G T 7: 28,105,055 V1863L probably benign Het
G2e3 T C 12: 51,357,194 probably null Het
Gabrr2 T C 4: 33,071,458 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gbgt1 C T 2: 28,503,218 P106L probably damaging Het
Gm13023 T C 4: 143,795,032 F406S probably benign Het
Gm6657 A C 12: 78,197,453 N60T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,205,024 E927G probably damaging Het
Hfm1 T A 5: 106,917,562 I84F possibly damaging Het
Htt G T 5: 34,877,151 D1989Y probably damaging Het
Ihh C T 1: 74,946,277 A350T probably benign Het
Irx4 G C 13: 73,265,539 A43P probably benign Het
Itk A G 11: 46,338,111 V414A probably benign Het
Itsn2 A T 12: 4,653,535 I744L probably benign Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Morc3 A G 16: 93,862,539 probably null Het
Msc A T 1: 14,755,556 C65S probably benign Het
Mybpc1 A G 10: 88,523,014 V343A probably damaging Het
Myo5c T C 9: 75,288,074 I1218T possibly damaging Het
Mypn C T 10: 63,120,186 V1163I probably benign Het
Obox3 A T 7: 15,626,288 M152K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1204 T A 2: 88,852,655 L235H probably damaging Het
Olfr1264 T A 2: 90,021,923 T48S probably benign Het
Olfr328 A G 11: 58,552,143 V32A probably benign Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prss23 A T 7: 89,509,966 D298E probably benign Het
Rab4b A T 7: 27,176,162 N31K probably benign Het
Ros1 A G 10: 52,090,944 probably null Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Rtl1 A T 12: 109,590,302 L1701Q probably damaging Het
Sbno1 T A 5: 124,392,741 N831Y probably benign Het
Selp A G 1: 164,126,586 K152E possibly damaging Het
Sema4b A G 7: 80,224,886 T675A probably benign Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Slco1a4 T A 6: 141,830,707 I196F probably damaging Het
Spata13 G A 14: 60,747,541 S828N probably benign Het
Stard13 A T 5: 151,047,801 Y643* probably null Het
Tll1 T C 8: 64,085,488 H374R probably damaging Het
Trmt10a T A 3: 138,147,504 I42K probably damaging Het
Trmu A T 15: 85,896,408 probably null Het
Trp53 T A 11: 69,588,546 D183E probably benign Het
Ttc22 T G 4: 106,636,757 F305V probably damaging Het
Unc13c A G 9: 73,749,688 F1077S possibly damaging Het
Utrn T A 10: 12,640,983 Q2289L probably damaging Het
Vmn1r65 C A 7: 6,008,810 E142* probably null Het
Vmn2r63 A T 7: 42,928,277 V279D probably benign Het
Zfp810 G A 9: 22,278,829 T261I possibly damaging Het
Zkscan17 A G 11: 59,502,918 probably null Het
Other mutations in Abcb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Abcb1b APN 5 8827704 missense probably benign 0.34
IGL00979:Abcb1b APN 5 8825293 splice site probably benign
IGL02157:Abcb1b APN 5 8805487 splice site probably benign
IGL02478:Abcb1b APN 5 8806018 missense probably damaging 0.98
IGL03174:Abcb1b APN 5 8827752 missense probably benign 0.03
IGL03189:Abcb1b APN 5 8845814 missense probably benign
IGL03195:Abcb1b APN 5 8853607 missense possibly damaging 0.83
PIT4283001:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R0049:Abcb1b UTSW 5 8825661 missense probably damaging 1.00
R0166:Abcb1b UTSW 5 8853468 missense probably damaging 1.00
R0254:Abcb1b UTSW 5 8827409 missense probably benign
R0319:Abcb1b UTSW 5 8827428 missense probably benign 0.01
R0358:Abcb1b UTSW 5 8821423 missense probably benign 0.16
R0365:Abcb1b UTSW 5 8806009 missense probably damaging 1.00
R0408:Abcb1b UTSW 5 8853446 missense probably damaging 0.98
R0521:Abcb1b UTSW 5 8864238 missense probably damaging 1.00
R0533:Abcb1b UTSW 5 8864113 critical splice acceptor site probably null
R0847:Abcb1b UTSW 5 8845764 missense probably damaging 0.99
R1037:Abcb1b UTSW 5 8825657 missense probably benign 0.03
R1432:Abcb1b UTSW 5 8837771 missense possibly damaging 0.69
R1437:Abcb1b UTSW 5 8821436 missense possibly damaging 0.90
R1520:Abcb1b UTSW 5 8814768 missense probably damaging 1.00
R1686:Abcb1b UTSW 5 8798782 missense probably damaging 0.97
R1700:Abcb1b UTSW 5 8849537 missense probably benign 0.44
R1973:Abcb1b UTSW 5 8812746 missense probably benign 0.01
R1993:Abcb1b UTSW 5 8821322 missense possibly damaging 0.61
R2157:Abcb1b UTSW 5 8824791 missense probably benign 0.37
R2207:Abcb1b UTSW 5 8824803 missense probably benign 0.23
R2968:Abcb1b UTSW 5 8861485 missense probably damaging 1.00
R3858:Abcb1b UTSW 5 8813581 missense probably benign 0.11
R4223:Abcb1b UTSW 5 8813722 missense probably damaging 0.97
R4379:Abcb1b UTSW 5 8865875 missense probably benign 0.00
R4674:Abcb1b UTSW 5 8810615 missense probably benign
R4964:Abcb1b UTSW 5 8812671 missense probably benign 0.00
R4964:Abcb1b UTSW 5 8861602 missense probably damaging 1.00
R5167:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R5216:Abcb1b UTSW 5 8813705 missense probably benign 0.04
R5328:Abcb1b UTSW 5 8837694 missense possibly damaging 0.69
R5391:Abcb1b UTSW 5 8805481 missense probably null 0.00
R6047:Abcb1b UTSW 5 8806066 missense probably damaging 1.00
R6157:Abcb1b UTSW 5 8824245 missense possibly damaging 0.81
R6293:Abcb1b UTSW 5 8853493 missense probably benign 0.05
R6493:Abcb1b UTSW 5 8824698 missense probably damaging 1.00
R6593:Abcb1b UTSW 5 8853491 missense probably benign
R6799:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R6944:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R7028:Abcb1b UTSW 5 8805441 missense probably damaging 0.99
R7227:Abcb1b UTSW 5 8825593 missense probably damaging 1.00
R7495:Abcb1b UTSW 5 8865871 missense probably damaging 1.00
R7573:Abcb1b UTSW 5 8828866 missense possibly damaging 0.80
R7681:Abcb1b UTSW 5 8849619 missense probably benign 0.00
R7827:Abcb1b UTSW 5 8837747 missense probably damaging 0.96
R7860:Abcb1b UTSW 5 8832258 missense probably benign 0.12
R7961:Abcb1b UTSW 5 8828870 missense possibly damaging 0.65
R8009:Abcb1b UTSW 5 8828870 missense possibly damaging 0.65
R8054:Abcb1b UTSW 5 8824272 missense probably benign
R8226:Abcb1b UTSW 5 8821390 missense probably damaging 1.00
R8283:Abcb1b UTSW 5 8806086 missense probably damaging 1.00
R8286:Abcb1b UTSW 5 8864119 missense probably damaging 1.00
R8362:Abcb1b UTSW 5 8798758 missense probably benign 0.00
R8387:Abcb1b UTSW 5 8824698 missense probably damaging 1.00
X0025:Abcb1b UTSW 5 8824515 missense possibly damaging 0.91
X0061:Abcb1b UTSW 5 8864269 splice site probably null
Z1176:Abcb1b UTSW 5 8827441 missense probably benign
Z1177:Abcb1b UTSW 5 8837596 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGCTTACTCATCAGTTCCC -3'
(R):5'- CCAGAGGCACATCTTCATCC -3'

Sequencing Primer
(F):5'- CTCATCAGTTCCCATAATAACGTG -3'
(R):5'- TCCCAAAGGTTGAGGACACTTG -3'
Posted On2016-09-06