Mutagenetix > Incidental Mutation

Incidental Mutation 'R5399:Golga3'

429853

Institutional Source

Beutler Lab

Gene Symbol

Golga3

Ensembl Gene

ENSMUSG00000029502

Gene Name

golgi autoantigen, golgin subfamily a, 3

Synonyms

repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2

MMRRC Submission

042970-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5399 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110176701-110226470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110205024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 927 (E927G)

Ref Sequence

ENSEMBL: ENSMUSP00000031477 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031477
AA Change: E927G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: E927G

Domain	Start	End	E-Value	Type
internal_repeat_1	24	49	7.67e-5	PROSPERO
internal_repeat_1	91	116	7.67e-5	PROSPERO
low complexity region	232	245	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	422	441	N/A	INTRINSIC
internal_repeat_2	444	484	7.67e-5	PROSPERO
low complexity region	534	548	N/A	INTRINSIC
internal_repeat_2	587	624	7.67e-5	PROSPERO
coiled coil region	656	1379	N/A	INTRINSIC
coiled coil region	1417	1453	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112512
AA Change: E887G

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: E887G

Domain	Start	End	E-Value	Type
internal_repeat_2	3	24	9.29e-5	PROSPERO
low complexity region	192	205	N/A	INTRINSIC
low complexity region	229	248	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	322	335	N/A	INTRINSIC
low complexity region	382	401	N/A	INTRINSIC
internal_repeat_1	404	444	4.91e-5	PROSPERO
low complexity region	494	508	N/A	INTRINSIC
internal_repeat_1	547	584	4.91e-5	PROSPERO
low complexity region	705	717	N/A	INTRINSIC
low complexity region	792	809	N/A	INTRINSIC
low complexity region	1105	1117	N/A	INTRINSIC
low complexity region	1220	1228	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
internal_repeat_2	1333	1359	9.29e-5	PROSPERO
coiled coil region	1377	1413	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199123

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	G	T	2: 152,440,868	L214F	probably damaging	Het
Abcb1b	T	C	5: 8,827,410	S657P	probably benign	Het
Abcb5	T	A	12: 118,911,499	Y646F	probably benign	Het
Agl	A	T	3: 116,781,628	L620Q	probably damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Arhgap23	A	G	11: 97,500,917	N1420S	probably damaging	Het
Arntl2	T	G	6: 146,822,661	D350E	probably damaging	Het
Barx2	A	G	9: 31,854,111		probably null	Het
Birc6	C	A	17: 74,604,578	S28R	possibly damaging	Het
Btbd19	G	A	4: 117,123,760	A104V	probably damaging	Het
Casp4	A	T	9: 5,324,928	K247*	probably null	Het
Clk4	T	C	11: 51,275,257	Y17H	probably damaging	Het
Cntnap1	A	G	11: 101,183,316	Q722R	probably benign	Het
Col6a6	A	G	9: 105,709,107	V1905A	possibly damaging	Het
Csmd1	C	A	8: 16,710,597	G174V	probably damaging	Het
Cul1	T	A	6: 47,485,084		probably null	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Dnaaf2	A	G	12: 69,196,742	I515T	probably damaging	Het
Fbn1	T	C	2: 125,332,333	I1868V	possibly damaging	Het
Fcgbp	G	T	7: 28,105,055	V1863L	probably benign	Het
G2e3	T	C	12: 51,357,194		probably null	Het
Gabrr2	T	C	4: 33,071,458		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gbgt1	C	T	2: 28,503,218	P106L	probably damaging	Het
Gm13023	T	C	4: 143,795,032	F406S	probably benign	Het
Gm6657	A	C	12: 78,197,453	N60T	probably damaging	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Hfm1	T	A	5: 106,917,562	I84F	possibly damaging	Het
Htt	G	T	5: 34,877,151	D1989Y	probably damaging	Het
Ihh	C	T	1: 74,946,277	A350T	probably benign	Het
Irx4	G	C	13: 73,265,539	A43P	probably benign	Het
Itk	A	G	11: 46,338,111	V414A	probably benign	Het
Itsn2	A	T	12: 4,653,535	I744L	probably benign	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Kif14	A	G	1: 136,503,324	D1153G	probably benign	Het
Morc3	A	G	16: 93,862,539		probably null	Het
Msc	A	T	1: 14,755,556	C65S	probably benign	Het
Mybpc1	A	G	10: 88,523,014	V343A	probably damaging	Het
Myo5c	T	C	9: 75,288,074	I1218T	possibly damaging	Het
Mypn	C	T	10: 63,120,186	V1163I	probably benign	Het
Obox3	A	T	7: 15,626,288	M152K	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1204	T	A	2: 88,852,655	L235H	probably damaging	Het
Olfr1264	T	A	2: 90,021,923	T48S	probably benign	Het
Olfr328	A	G	11: 58,552,143	V32A	probably benign	Het
Pcdhb21	G	T	18: 37,515,719	V634L	probably benign	Het
Ppp1r9b	G	A	11: 94,992,148	A201T	probably benign	Het
Prss23	A	T	7: 89,509,966	D298E	probably benign	Het
Rab4b	A	T	7: 27,176,162	N31K	probably benign	Het
Ros1	A	G	10: 52,090,944		probably null	Het
Rragb	G	A	X: 153,140,554	G24E	probably damaging	Het
Rtl1	A	T	12: 109,590,302	L1701Q	probably damaging	Het
Sbno1	T	A	5: 124,392,741	N831Y	probably benign	Het
Selp	A	G	1: 164,126,586	K152E	possibly damaging	Het
Sema4b	A	G	7: 80,224,886	T675A	probably benign	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Slco1a4	T	A	6: 141,830,707	I196F	probably damaging	Het
Spata13	G	A	14: 60,747,541	S828N	probably benign	Het
Stard13	A	T	5: 151,047,801	Y643*	probably null	Het
Tll1	T	C	8: 64,085,488	H374R	probably damaging	Het
Trmt10a	T	A	3: 138,147,504	I42K	probably damaging	Het
Trmu	A	T	15: 85,896,408		probably null	Het
Trp53	T	A	11: 69,588,546	D183E	probably benign	Het
Ttc22	T	G	4: 106,636,757	F305V	probably damaging	Het
Unc13c	A	G	9: 73,749,688	F1077S	possibly damaging	Het
Utrn	T	A	10: 12,640,983	Q2289L	probably damaging	Het
Vmn1r65	C	A	7: 6,008,810	E142*	probably null	Het
Vmn2r63	A	T	7: 42,928,277	V279D	probably benign	Het
Zfp810	G	A	9: 22,278,829	T261I	possibly damaging	Het
Zkscan17	A	G	11: 59,502,918		probably null	Het

Other mutations in Golga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Golga3	APN	5	110220887	missense	probably damaging	1.00
IGL00594:Golga3	APN	5	110204975	missense	probably benign	0.37
IGL00672:Golga3	APN	5	110212244	missense	probably damaging	1.00
IGL00821:Golga3	APN	5	110204933	missense	possibly damaging	0.74
IGL01015:Golga3	APN	5	110187717	missense	probably benign	0.04
IGL01408:Golga3	APN	5	110217809	critical splice acceptor site	probably null
IGL01651:Golga3	APN	5	110192905	critical splice acceptor site	probably null
IGL02617:Golga3	APN	5	110188746	missense	probably benign	0.26
cles	UTSW	5	110188707	nonsense	probably null
tenta	UTSW	5	110218130	nonsense	probably null
PIT4544001:Golga3	UTSW	5	110188690	missense	possibly damaging	0.94
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0591:Golga3	UTSW	5	110188743	missense	probably damaging	1.00
R1219:Golga3	UTSW	5	110184349	nonsense	probably null
R1297:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1299:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1589:Golga3	UTSW	5	110181783	missense	probably damaging	1.00
R1795:Golga3	UTSW	5	110207627	missense	possibly damaging	0.47
R1992:Golga3	UTSW	5	110192973	missense	probably damaging	0.96
R2116:Golga3	UTSW	5	110187395	missense	probably damaging	0.97
R2130:Golga3	UTSW	5	110202939	critical splice donor site	probably null
R2153:Golga3	UTSW	5	110187990	splice site	probably null
R2158:Golga3	UTSW	5	110187361	missense	probably damaging	1.00
R2357:Golga3	UTSW	5	110202648	missense	probably damaging	1.00
R2397:Golga3	UTSW	5	110205877	splice site	probably benign
R2418:Golga3	UTSW	5	110201868	missense	probably damaging	1.00
R2495:Golga3	UTSW	5	110207596	missense	probably damaging	0.99
R2763:Golga3	UTSW	5	110204895	missense	possibly damaging	0.87
R3276:Golga3	UTSW	5	110201998	splice site	probably benign
R3614:Golga3	UTSW	5	110220908	missense	probably damaging	1.00
R4520:Golga3	UTSW	5	110203751	nonsense	probably null
R5001:Golga3	UTSW	5	110205777	missense	probably damaging	1.00
R5046:Golga3	UTSW	5	110192940	missense	probably damaging	0.99
R5157:Golga3	UTSW	5	110202671	missense	probably benign	0.00
R5191:Golga3	UTSW	5	110184307	intron	probably benign
R5376:Golga3	UTSW	5	110220945	critical splice donor site	probably null
R5407:Golga3	UTSW	5	110201990	nonsense	probably null
R5884:Golga3	UTSW	5	110216895	missense	probably damaging	1.00
R6087:Golga3	UTSW	5	110204946	missense	probably damaging	0.99
R6526:Golga3	UTSW	5	110204895	missense	probably damaging	0.98
R6651:Golga3	UTSW	5	110218130	nonsense	probably null
R7041:Golga3	UTSW	5	110208584	critical splice donor site	probably null
R7057:Golga3	UTSW	5	110188663	missense	probably damaging	1.00
R7078:Golga3	UTSW	5	110193087	missense	probably damaging	0.99
R7114:Golga3	UTSW	5	110202712	missense	probably benign	0.01
R7190:Golga3	UTSW	5	110209855	missense	probably damaging	1.00
R7405:Golga3	UTSW	5	110208446	missense	probably damaging	0.97
R7528:Golga3	UTSW	5	110212232	missense	probably damaging	1.00
R7638:Golga3	UTSW	5	110205828	missense	probably benign
R7760:Golga3	UTSW	5	110205850	missense	probably benign	0.39
R8099:Golga3	UTSW	5	110188707	nonsense	probably null
R8144:Golga3	UTSW	5	110185879	missense	probably damaging	0.99
R8558:Golga3	UTSW	5	110208555	missense	possibly damaging	0.83
R8708:Golga3	UTSW	5	110202855	missense	probably benign	0.05
R8887:Golga3	UTSW	5	110205760	intron	probably benign
R9039:Golga3	UTSW	5	110204933	missense	probably benign	0.00
R9045:Golga3	UTSW	5	110193097	missense	probably benign	0.00
R9057:Golga3	UTSW	5	110184599	missense	probably damaging	1.00
R9100:Golga3	UTSW	5	110189678	missense	probably benign	0.31
R9112:Golga3	UTSW	5	110185891	missense	probably benign	0.08
R9198:Golga3	UTSW	5	110207753	missense	probably benign	0.11
R9755:Golga3	UTSW	5	110192981	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- GGCTGGACTCTGAGATGAAG -3'
(R):5'- ATGTCCTGATCTGAGCTCACTC -3'

Sequencing Primer
(F):5'- CTGGACTCTGAGATGAAGGAACTG -3'
(R):5'- GGCATCACAGCATGCATTTATCTG -3'

Posted On

2016-09-06