Incidental Mutation 'R5399:Golga3'
ID429853
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Namegolgi autoantigen, golgin subfamily a, 3
Synonymsrepro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission 042970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5399 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location110176701-110226470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110205024 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 927 (E927G)
Ref Sequence ENSEMBL: ENSMUSP00000031477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
Predicted Effect probably damaging
Transcript: ENSMUST00000031477
AA Change: E927G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: E927G

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112512
AA Change: E887G

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: E887G

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199123
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,440,868 L214F probably damaging Het
Abcb1b T C 5: 8,827,410 S657P probably benign Het
Abcb5 T A 12: 118,911,499 Y646F probably benign Het
Agl A T 3: 116,781,628 L620Q probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Arhgap23 A G 11: 97,500,917 N1420S probably damaging Het
Arntl2 T G 6: 146,822,661 D350E probably damaging Het
Barx2 A G 9: 31,854,111 probably null Het
Birc6 C A 17: 74,604,578 S28R possibly damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Casp4 A T 9: 5,324,928 K247* probably null Het
Clk4 T C 11: 51,275,257 Y17H probably damaging Het
Cntnap1 A G 11: 101,183,316 Q722R probably benign Het
Col6a6 A G 9: 105,709,107 V1905A possibly damaging Het
Csmd1 C A 8: 16,710,597 G174V probably damaging Het
Cul1 T A 6: 47,485,084 probably null Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Dnaaf2 A G 12: 69,196,742 I515T probably damaging Het
Fbn1 T C 2: 125,332,333 I1868V possibly damaging Het
Fcgbp G T 7: 28,105,055 V1863L probably benign Het
G2e3 T C 12: 51,357,194 probably null Het
Gabrr2 T C 4: 33,071,458 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gbgt1 C T 2: 28,503,218 P106L probably damaging Het
Gm13023 T C 4: 143,795,032 F406S probably benign Het
Gm6657 A C 12: 78,197,453 N60T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hfm1 T A 5: 106,917,562 I84F possibly damaging Het
Htt G T 5: 34,877,151 D1989Y probably damaging Het
Ihh C T 1: 74,946,277 A350T probably benign Het
Irx4 G C 13: 73,265,539 A43P probably benign Het
Itk A G 11: 46,338,111 V414A probably benign Het
Itsn2 A T 12: 4,653,535 I744L probably benign Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Morc3 A G 16: 93,862,539 probably null Het
Msc A T 1: 14,755,556 C65S probably benign Het
Mybpc1 A G 10: 88,523,014 V343A probably damaging Het
Myo5c T C 9: 75,288,074 I1218T possibly damaging Het
Mypn C T 10: 63,120,186 V1163I probably benign Het
Obox3 A T 7: 15,626,288 M152K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1204 T A 2: 88,852,655 L235H probably damaging Het
Olfr1264 T A 2: 90,021,923 T48S probably benign Het
Olfr328 A G 11: 58,552,143 V32A probably benign Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prss23 A T 7: 89,509,966 D298E probably benign Het
Rab4b A T 7: 27,176,162 N31K probably benign Het
Ros1 A G 10: 52,090,944 probably null Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Rtl1 A T 12: 109,590,302 L1701Q probably damaging Het
Sbno1 T A 5: 124,392,741 N831Y probably benign Het
Selp A G 1: 164,126,586 K152E possibly damaging Het
Sema4b A G 7: 80,224,886 T675A probably benign Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Slco1a4 T A 6: 141,830,707 I196F probably damaging Het
Spata13 G A 14: 60,747,541 S828N probably benign Het
Stard13 A T 5: 151,047,801 Y643* probably null Het
Tll1 T C 8: 64,085,488 H374R probably damaging Het
Trmt10a T A 3: 138,147,504 I42K probably damaging Het
Trmu A T 15: 85,896,408 probably null Het
Trp53 T A 11: 69,588,546 D183E probably benign Het
Ttc22 T G 4: 106,636,757 F305V probably damaging Het
Unc13c A G 9: 73,749,688 F1077S possibly damaging Het
Utrn T A 10: 12,640,983 Q2289L probably damaging Het
Vmn1r65 C A 7: 6,008,810 E142* probably null Het
Vmn2r63 A T 7: 42,928,277 V279D probably benign Het
Zfp810 G A 9: 22,278,829 T261I possibly damaging Het
Zkscan17 A G 11: 59,502,918 probably null Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTGGACTCTGAGATGAAG -3'
(R):5'- ATGTCCTGATCTGAGCTCACTC -3'

Sequencing Primer
(F):5'- CTGGACTCTGAGATGAAGGAACTG -3'
(R):5'- GGCATCACAGCATGCATTTATCTG -3'
Posted On2016-09-06