Incidental Mutation 'R5399:Unc13c'
ID 429875
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Name unc-13 homolog C
Synonyms D9Ertd414e, 1500037O19Rik, Munc13-3, Unc13h3
MMRRC Submission 042970-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5399 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 73386704-73876248 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73656970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1077 (F1077S)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
AlphaFold Q8K0T7
Predicted Effect possibly damaging
Transcript: ENSMUST00000075245
AA Change: F1077S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: F1077S

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184666
AA Change: F1077S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: F1077S

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,282,788 (GRCm39) L214F probably damaging Het
Abcb1b T C 5: 8,877,410 (GRCm39) S657P probably benign Het
Abcb5 T A 12: 118,875,234 (GRCm39) Y646F probably benign Het
Agl A T 3: 116,575,277 (GRCm39) L620Q probably damaging Het
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Arhgap23 A G 11: 97,391,743 (GRCm39) N1420S probably damaging Het
Barx2 A G 9: 31,765,407 (GRCm39) probably null Het
Birc6 C A 17: 74,911,573 (GRCm39) S28R possibly damaging Het
Bmal2 T G 6: 146,724,159 (GRCm39) D350E probably damaging Het
Btbd19 G A 4: 116,980,957 (GRCm39) A104V probably damaging Het
Casp4 A T 9: 5,324,928 (GRCm39) K247* probably null Het
Ccdc196 A C 12: 78,244,227 (GRCm39) N60T probably damaging Het
Clk4 T C 11: 51,166,084 (GRCm39) Y17H probably damaging Het
Cntnap1 A G 11: 101,074,142 (GRCm39) Q722R probably benign Het
Col6a6 A G 9: 105,586,306 (GRCm39) V1905A possibly damaging Het
Csmd1 C A 8: 16,760,613 (GRCm39) G174V probably damaging Het
Cul1 T A 6: 47,462,018 (GRCm39) probably null Het
Cux1 T C 5: 136,281,458 (GRCm39) E568G possibly damaging Het
Dnaaf2 A G 12: 69,243,516 (GRCm39) I515T probably damaging Het
Fbn1 T C 2: 125,174,253 (GRCm39) I1868V possibly damaging Het
Fcgbp G T 7: 27,804,480 (GRCm39) V1863L probably benign Het
G2e3 T C 12: 51,403,977 (GRCm39) probably null Het
Gabrr2 T C 4: 33,071,458 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gbgt1 C T 2: 28,393,230 (GRCm39) P106L probably damaging Het
Golga3 A G 5: 110,352,890 (GRCm39) E927G probably damaging Het
Hfm1 T A 5: 107,065,428 (GRCm39) I84F possibly damaging Het
Htt G T 5: 35,034,495 (GRCm39) D1989Y probably damaging Het
Ihh C T 1: 74,985,436 (GRCm39) A350T probably benign Het
Irx4 G C 13: 73,413,658 (GRCm39) A43P probably benign Het
Itk A G 11: 46,228,938 (GRCm39) V414A probably benign Het
Itsn2 A T 12: 4,703,535 (GRCm39) I744L probably benign Het
Kdm5b G A 1: 134,549,836 (GRCm39) probably null Het
Kif14 A G 1: 136,431,062 (GRCm39) D1153G probably benign Het
Morc3 A G 16: 93,659,427 (GRCm39) probably null Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Msc A T 1: 14,825,780 (GRCm39) C65S probably benign Het
Mybpc1 A G 10: 88,358,876 (GRCm39) V343A probably damaging Het
Myo5c T C 9: 75,195,356 (GRCm39) I1218T possibly damaging Het
Mypn C T 10: 62,955,965 (GRCm39) V1163I probably benign Het
Obox3 A T 7: 15,360,213 (GRCm39) M152K probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2t47 A G 11: 58,442,969 (GRCm39) V32A probably benign Het
Or4c106 T A 2: 88,682,999 (GRCm39) L235H probably damaging Het
Or4c3 T A 2: 89,852,267 (GRCm39) T48S probably benign Het
Pcdhb21 G T 18: 37,648,772 (GRCm39) V634L probably benign Het
Ppp1r9b G A 11: 94,882,974 (GRCm39) A201T probably benign Het
Pramel25 T C 4: 143,521,602 (GRCm39) F406S probably benign Het
Prss23 A T 7: 89,159,174 (GRCm39) D298E probably benign Het
Rab4b A T 7: 26,875,587 (GRCm39) N31K probably benign Het
Ros1 A G 10: 51,967,040 (GRCm39) probably null Het
Rragb G A X: 151,923,550 (GRCm39) G24E probably damaging Het
Rtl1 A T 12: 109,556,736 (GRCm39) L1701Q probably damaging Het
Sbno1 T A 5: 124,530,804 (GRCm39) N831Y probably benign Het
Selp A G 1: 163,954,155 (GRCm39) K152E possibly damaging Het
Sema4b A G 7: 79,874,634 (GRCm39) T675A probably benign Het
Slc36a3 T C 11: 55,037,006 (GRCm39) I100V possibly damaging Het
Slco1a4 T A 6: 141,776,433 (GRCm39) I196F probably damaging Het
Spata13 G A 14: 60,984,990 (GRCm39) S828N probably benign Het
Stard13 A T 5: 150,971,266 (GRCm39) Y643* probably null Het
Tll1 T C 8: 64,538,522 (GRCm39) H374R probably damaging Het
Trmt10a T A 3: 137,853,265 (GRCm39) I42K probably damaging Het
Trmu A T 15: 85,780,609 (GRCm39) probably null Het
Trp53 T A 11: 69,479,372 (GRCm39) D183E probably benign Het
Ttc22 T G 4: 106,493,954 (GRCm39) F305V probably damaging Het
Utrn T A 10: 12,516,727 (GRCm39) Q2289L probably damaging Het
Vmn1r65 C A 7: 6,011,809 (GRCm39) E142* probably null Het
Vmn2r63 A T 7: 42,577,701 (GRCm39) V279D probably benign Het
Zfp810 G A 9: 22,190,125 (GRCm39) T261I possibly damaging Het
Zkscan17 A G 11: 59,393,744 (GRCm39) probably null Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73,643,985 (GRCm39) missense probably damaging 0.99
IGL00693:Unc13c APN 9 73,665,884 (GRCm39) missense probably benign 0.18
IGL01022:Unc13c APN 9 73,424,610 (GRCm39) missense probably benign 0.06
IGL01088:Unc13c APN 9 73,839,563 (GRCm39) missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73,840,479 (GRCm39) missense probably benign 0.05
IGL01131:Unc13c APN 9 73,471,335 (GRCm39) missense probably benign
IGL01135:Unc13c APN 9 73,392,175 (GRCm39) missense probably damaging 1.00
IGL01393:Unc13c APN 9 73,447,552 (GRCm39) missense probably benign 0.06
IGL01752:Unc13c APN 9 73,839,093 (GRCm39) missense probably benign 0.01
IGL01893:Unc13c APN 9 73,600,648 (GRCm39) missense probably benign 0.15
IGL01897:Unc13c APN 9 73,453,309 (GRCm39) missense probably damaging 0.99
IGL01936:Unc13c APN 9 73,600,524 (GRCm39) missense probably benign 0.07
IGL02122:Unc13c APN 9 73,641,679 (GRCm39) splice site probably benign
IGL02341:Unc13c APN 9 73,840,492 (GRCm39) missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73,839,910 (GRCm39) missense probably benign 0.01
IGL02545:Unc13c APN 9 73,388,357 (GRCm39) missense probably damaging 0.98
IGL02709:Unc13c APN 9 73,466,238 (GRCm39) missense probably benign 0.00
IGL02815:Unc13c APN 9 73,447,545 (GRCm39) missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73,388,349 (GRCm39) nonsense probably null
IGL03117:Unc13c APN 9 73,441,307 (GRCm39) missense probably benign 0.03
IGL03260:Unc13c APN 9 73,838,626 (GRCm39) missense probably benign 0.11
Feeling UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
Inkling UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
notion UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
BB001:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
BB011:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73,656,829 (GRCm39) missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73,391,021 (GRCm39) missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73,600,583 (GRCm39) missense probably benign 0.07
R0039:Unc13c UTSW 9 73,576,847 (GRCm39) splice site probably benign
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0308:Unc13c UTSW 9 73,388,400 (GRCm39) missense probably benign 0.04
R0344:Unc13c UTSW 9 73,838,067 (GRCm39) missense probably benign 0.39
R0421:Unc13c UTSW 9 73,840,492 (GRCm39) missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73,438,265 (GRCm39) splice site probably benign
R0655:Unc13c UTSW 9 73,838,235 (GRCm39) missense probably damaging 0.96
R1013:Unc13c UTSW 9 73,840,614 (GRCm39) missense probably benign 0.45
R1293:Unc13c UTSW 9 73,481,356 (GRCm39) missense probably benign 0.06
R1493:Unc13c UTSW 9 73,546,350 (GRCm39) missense probably benign 0.27
R1675:Unc13c UTSW 9 73,546,332 (GRCm39) critical splice donor site probably null
R1789:Unc13c UTSW 9 73,663,621 (GRCm39) missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73,390,897 (GRCm39) splice site probably null
R2055:Unc13c UTSW 9 73,643,832 (GRCm39) missense probably damaging 1.00
R2060:Unc13c UTSW 9 73,572,938 (GRCm39) missense probably damaging 0.99
R2420:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2421:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2422:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R3415:Unc13c UTSW 9 73,839,868 (GRCm39) missense probably benign 0.00
R3423:Unc13c UTSW 9 73,837,935 (GRCm39) missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73,838,240 (GRCm39) missense probably benign 0.00
R3857:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3859:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3895:Unc13c UTSW 9 73,840,805 (GRCm39) missense probably benign
R4038:Unc13c UTSW 9 73,441,188 (GRCm39) critical splice donor site probably null
R4077:Unc13c UTSW 9 73,643,821 (GRCm39) nonsense probably null
R4125:Unc13c UTSW 9 73,481,289 (GRCm39) critical splice donor site probably null
R4128:Unc13c UTSW 9 73,641,819 (GRCm39) missense probably damaging 1.00
R4235:Unc13c UTSW 9 73,438,234 (GRCm39) missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73,641,786 (GRCm39) missense probably damaging 1.00
R4307:Unc13c UTSW 9 73,600,649 (GRCm39) missense probably benign 0.06
R4658:Unc13c UTSW 9 73,840,108 (GRCm39) missense probably damaging 1.00
R4694:Unc13c UTSW 9 73,479,636 (GRCm39) missense probably benign 0.00
R4735:Unc13c UTSW 9 73,600,620 (GRCm39) missense probably benign 0.00
R4744:Unc13c UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
R4795:Unc13c UTSW 9 73,839,469 (GRCm39) missense probably damaging 0.97
R4827:Unc13c UTSW 9 73,838,568 (GRCm39) missense probably damaging 1.00
R4838:Unc13c UTSW 9 73,839,354 (GRCm39) missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73,587,716 (GRCm39) missense probably benign 0.02
R4873:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4875:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4876:Unc13c UTSW 9 73,656,821 (GRCm39) missense probably damaging 1.00
R4905:Unc13c UTSW 9 73,587,674 (GRCm39) missense probably benign
R4912:Unc13c UTSW 9 73,481,304 (GRCm39) missense probably damaging 0.99
R5026:Unc13c UTSW 9 73,838,185 (GRCm39) missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73,840,654 (GRCm39) missense probably benign 0.26
R5151:Unc13c UTSW 9 73,838,757 (GRCm39) missense probably benign 0.02
R5171:Unc13c UTSW 9 73,665,236 (GRCm39) missense probably benign
R5244:Unc13c UTSW 9 73,433,233 (GRCm39) critical splice donor site probably null
R5342:Unc13c UTSW 9 73,838,105 (GRCm39) missense probably benign 0.00
R5409:Unc13c UTSW 9 73,485,672 (GRCm39) missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73,453,271 (GRCm39) missense probably benign
R5680:Unc13c UTSW 9 73,839,884 (GRCm39) missense probably damaging 1.00
R5681:Unc13c UTSW 9 73,453,357 (GRCm39) splice site probably null
R5728:Unc13c UTSW 9 73,466,238 (GRCm39) missense probably benign 0.01
R5762:Unc13c UTSW 9 73,719,649 (GRCm39) missense probably benign 0.00
R5764:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R5829:Unc13c UTSW 9 73,600,650 (GRCm39) missense probably benign 0.15
R5894:Unc13c UTSW 9 73,600,486 (GRCm39) critical splice donor site probably null
R5936:Unc13c UTSW 9 73,485,774 (GRCm39) missense probably damaging 1.00
R6043:Unc13c UTSW 9 73,643,933 (GRCm39) missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73,838,166 (GRCm39) missense probably benign
R6148:Unc13c UTSW 9 73,600,648 (GRCm39) missense probably benign 0.15
R6207:Unc13c UTSW 9 73,665,910 (GRCm39) missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73,606,451 (GRCm39) missense probably damaging 1.00
R6338:Unc13c UTSW 9 73,641,729 (GRCm39) missense probably damaging 0.99
R6615:Unc13c UTSW 9 73,837,890 (GRCm39) missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73,839,259 (GRCm39) missense probably benign 0.39
R7053:Unc13c UTSW 9 73,839,579 (GRCm39) missense probably damaging 1.00
R7223:Unc13c UTSW 9 73,536,473 (GRCm39) missense probably benign 0.44
R7259:Unc13c UTSW 9 73,424,645 (GRCm39) missense probably benign 0.00
R7353:Unc13c UTSW 9 73,481,355 (GRCm39) missense probably benign 0.00
R7357:Unc13c UTSW 9 73,840,811 (GRCm39) small insertion probably benign
R7357:Unc13c UTSW 9 73,840,810 (GRCm39) small insertion probably benign
R7607:Unc13c UTSW 9 73,576,817 (GRCm39) missense probably damaging 0.98
R7626:Unc13c UTSW 9 73,641,799 (GRCm39) missense probably damaging 1.00
R7639:Unc13c UTSW 9 73,840,450 (GRCm39) missense probably damaging 0.99
R7657:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R7665:Unc13c UTSW 9 73,587,756 (GRCm39) missense probably benign 0.28
R7704:Unc13c UTSW 9 73,606,494 (GRCm39) missense probably benign 0.27
R7776:Unc13c UTSW 9 73,602,232 (GRCm39) missense probably damaging 1.00
R7811:Unc13c UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73,388,391 (GRCm39) missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73,840,596 (GRCm39) missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73,602,159 (GRCm39) missense probably damaging 1.00
R7924:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
R8047:Unc13c UTSW 9 73,719,636 (GRCm39) nonsense probably null
R8167:Unc13c UTSW 9 73,643,985 (GRCm39) missense probably damaging 0.99
R8202:Unc13c UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
R8210:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably benign 0.13
R8352:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8368:Unc13c UTSW 9 73,838,070 (GRCm39) missense probably benign 0.15
R8452:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8535:Unc13c UTSW 9 73,447,653 (GRCm39) missense probably benign
R8677:Unc13c UTSW 9 73,840,243 (GRCm39) missense probably benign 0.00
R8700:Unc13c UTSW 9 73,479,679 (GRCm39) missense probably benign 0.44
R8848:Unc13c UTSW 9 73,433,263 (GRCm39) missense probably benign
R8902:Unc13c UTSW 9 73,656,830 (GRCm39) missense probably damaging 0.97
R8953:Unc13c UTSW 9 73,840,044 (GRCm39) missense probably benign 0.00
R8961:Unc13c UTSW 9 73,839,524 (GRCm39) missense probably benign 0.06
R9015:Unc13c UTSW 9 73,453,322 (GRCm39) missense probably benign
R9114:Unc13c UTSW 9 73,719,665 (GRCm39) missense probably benign 0.02
R9217:Unc13c UTSW 9 73,485,715 (GRCm39) missense probably damaging 1.00
R9252:Unc13c UTSW 9 73,424,553 (GRCm39) missense possibly damaging 0.80
R9273:Unc13c UTSW 9 73,839,862 (GRCm39) missense possibly damaging 0.96
R9317:Unc13c UTSW 9 73,447,662 (GRCm39) missense possibly damaging 0.88
R9412:Unc13c UTSW 9 73,839,772 (GRCm39) missense probably benign
R9505:Unc13c UTSW 9 73,838,824 (GRCm39) missense probably benign 0.22
R9516:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably damaging 0.99
R9528:Unc13c UTSW 9 73,837,960 (GRCm39) missense possibly damaging 0.48
R9567:Unc13c UTSW 9 73,536,485 (GRCm39) missense probably damaging 0.99
R9756:Unc13c UTSW 9 73,839,526 (GRCm39) missense probably benign 0.23
R9783:Unc13c UTSW 9 73,392,227 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGCAGGTCCTGACACTTCTC -3'
(R):5'- GGAGTTCTTCAGTTAAAACAGCC -3'

Sequencing Primer
(F):5'- CGTGGCATTTCACCCCAC -3'
(R):5'- CCAAACTGGGCTTTAAGAGAGAAG -3'
Posted On 2016-09-06